Dicranomyia (Idiopyga) intricata Nieminen 2008: 24 (misidentification)

Dicranomyia (Idiopyga) cf. intricata Salmela 2013: 38 (preliminary annotation to the Finnish list)

Male. Head. Vertex dark brown, with short black setae. Rostrum light brown with a few short dark setae. Palpus 5-segmented; first palpomere very short, globular, 1.5 times wider than long; other palpomeres elongated, p2 length 140 µm, p3 100 µm, p4 100 µm and p5 120 µm. First palpomere with a long ventral seta, approximately 2 times longer than width of palpomere. Second and third palpomeres with 5 setae, arranged in the apical half of segments. Fourth palpomere bearing ca. 12 setae and p5 with 13-15 setae, most of these on the apices of the segments. Antennae 14-segmented, dark brown, segments bearing black setae mostly exceeding width of respective segment; setae straight on scape (ca. 10 setae) and pecidel (ca. 15 setae), straight or curved on flagellomeres (ca. 5 setae on each flagellomere). Scape cylindrical, length 200 µm, width 75 µm, pedicel wider apically than basally, length 115 µm, width 75 µm. Flagellomeres oval, longer than wide; f1 length 120 µm, width 65 µm, f2 length 8 µm, width 5 µm, f10 length 110 µm, width 40 µm. Thorax mainly dark brown. Prescutum dark brown, only small yellowish spots on hind lateral corners. Scutum dark brown with longitudinal yellow median line and yellow lateral spots near wing base. Mediotergite and anepisternum dark brown, mediotergite sometimes with narrow yellowish anterior margin. Laterotergite and anepimeron yellowish brown. Katepisternum bicolored: anterior half dark brown, posterior half yellowish brown. Fore coxa brown, mid and hind coxae yellowish brown. Femorae light brown or brown, tibiae and tarsi dark brown. Length of fore femora 4500 µm, tibia 5250 µm, t1 3500 µm, t2 1100 µm, t3 875 µm, t4 300 µm, t5 175 µm, claw 130 µm. Length of mid femora 5575 µm, tibia 5625 µm, t1 3200 µm, t2 1150 µm, t3 625 µm, t4 275 µm, t5 175 µm, claw 130 µm. Length of hind femora 5600 µm, tibia 5750 µm, t1 3050 µm, t2 1150, t3 650 µm, t4 275 µm, t5 178 µm, claw 130 µm. Halter grayish-brown. Wing clear, veins light brown - brown, pterostigma brown (Fig. 1). Apical part of Sc1, R1, Rs, R3, R4+5, M1+2, M3, CuA1, CuA2, apices of A1 and A2 with macrotrichia, other veins bare. Sc1 ending in C before or opposite base of Rs (Fig. 1). Wing length 6.0-6.5 mm. Abdomen light brown - dark brown, tergites mainly dark, anterior sternites lighter than caudal sternites. Both sternites and tergites covered with short brown setae. 9th tergite and proctiger as in Fig. 2. Gonocoxite and gonostylus with complicated structure. Gonocoxite dark brown, sparsely covered with dark setae. Ventromesal lobe of gonocoxite consisting of two main branches, the main lobe (lgx) and its appendage (algx, Fig. 3). The main lobe (lgx) is rod-like, straight and elongated, apex angular, medially with a patch of hyaline curly setae. The appendage (algx) with two branches, proximal branch smaller, having a small hairy lobe, caudal branch larger in size, apically with tuft of rather long hyaline setae (Fig. 3a). Inner appendage of gonocoxite (iagx, Fig. 4a, b, c) sclerotized, curved structure, apically with number of stout, short setae; apex of iagx rounded and slightly wider than its stalk. Gonostylus consisting of two main lobes (dorsal [dg] and ventral [vg]), ventrobasal lobe of ventral gonostylus (lvg), rostral prolongation (rostrum) of ventral gonostylus (rm) and subrostral prolongation of ventral gonostylus (srm) (Figs 3b, 4). Dg long, narrow, pointed and bare, vg ball-like, weakly sclerotized, bearing setae and microtrichia (Figs 3b, 4a). Lvg tail-like, sinuous and weakly sclerotized, having patches of hyaline setae both basally and apically; apex of lvg oval (Fig. 3). Basal part of rm dorsally covered with dark brown plate, rm light brown, well sclerotized and elongated, bearing two strong spines; apex of rm rounded and rather narrow, bearing a few short setae (Fig. 4a). Srm strongly sclerotized, approximately as long as rm, projected proximad (i.e. toward parameres), being widest medially; srm with number of median and subapical stout black spines; apex rounded in dorsal view, bearing one black and two hyaline stout setae (Fig. 4c, d). Ventral surface of aedeagus bearing hyaline setosity, lateral margin of parameres weakly serrated (Fig. 5).

Figure 1.  

Dicranomyia (I.) boreobaltica Salmela sp.n., male wing, length 6.5 mm. DIPT-JS-2014-0114.

a

b

Figure 2.

Dicranomyia (I.) boreobaltica Salmela sp.n. male, details of male hypopygium.

a: 9th tergite, dorsal view.  
b: Proctiger, dorsal view.  

a

b

Figure 3.

Dicranomyia (I.) boreobaltica Salmela sp.n. male hypopygium, gonocoxite and gonostylus. gx=gonocoxite, algx=appendage of ventromesal lobe of gonocoxite, lgx=ventromesal lobe of gonocoxite, dg=dorsal lobe of gonostylus, vg=ventral lobe of gonostylus.

a: Gonocoxite and gonostylus, inner view.  
b: Gonocoxite and gonostylus, outer/lateral view.  

a

b

c

d

Figure 4.

Dicranomyia (I.) boreobaltica Salmela sp.n., details of male hypopygium. vg=ventral lobe of gonostylus, dg=dorsal lobe of gonostylus, gx=gonocoxite, rm=rostral prolongation (rostrum) of ventral gonostyle, srm=subrostral prolongation of ventral gonostyle, iagx=inner appendage of gonocoxite, lgx=ventromesal lobe of gonocoxite, algx=appendage of ventromesal lobe of gonocoxite.

a: Gonostylus and gonocoxite, dorsal view.  
b: Gonostylus and gonocoxite, mesal view.  
c: Gonostylus and gonocoxite, lateromesal view.  
d: Gonostylus and gonocoxite, ventromesal view.  

a

b

Figure 5.

Dicranomyia (I.) boreobaltica Salmela sp.n., male, aedeagus and parameres. aed=aedeagus, pm=paramere.

a: Ventral view.  
b: Lateral view.  

Female. In general, similar to male. Wing length 6.5 mm. Cerci short, ca. 240 µm in length. Infra-anal plate with a strong caudal peak (Fig. 6a). Other parts of the female post-abdomen are presented in Fig. 6.

a

b

Figure 6.

Dicranomyia (I.) boreobaltica Salmela sp.n., female, details of post-abdomen.

a: Cerci and 9th sternite, inner/ventral view. tg=tergite, st=sternite, iap=infra-anal plate. Vaginal apodeme is a triangular, hyaline membrane behind st9, which is not clearly seen in the photo.  
b: Hypogynial valves, inner/dorsal view. hv=hypogynial valves, st=sternite.  

a

b

Figure 7.

Dicranomyia (I.) intricata Alexander, type specimens.

a: Holotype, male, habitus, lateral view.  
b: Paratype, male, abdominal terminalia and hypopygium, dorsal view. Permanent slide, perhaps mounted in Canada balsam.  

a

b

Figure 8.

Dicranomyia (I.) intricata Alexander, details of male hypopygium.

a: 9th tergite, dorsal view.  
b: Proctiger, dorsal view.  

a

b

Figure 9.

Dicranomya (I.) intricata Alexander, male hypopygium, gonocoxite and gonostylus. gx=gonocoxite, algx=appendage of ventromesal lobe of gonocoxite, lgx=ventromesal lobe of gonocoxite, dg=dorsal lobe of gonostylus, vg=ventral lobe of gonostylus, lvg=ventrobasal lobe of ventral gonostyle.

a: Gonocoxite and gonostylus, inner view.  
b: Gonocoxite and gonostylus, outer/lateral view.  

a

b

c

d

Figure 10.

Dicranomyia (I.) intricata Alexander, details of male hypopygium. vg=ventral lobe of gonostylus, dg=dorsal lobe of gonostylus, gx=gonocoxite, rm=rostral prolongation (rostrum) of ventral gonostyle, srm=subrostral prolongation of ventral gonostyle, iagx=inner appendage of gonocoxite, lgx=ventromesal lobe of gonocoxite, algx=appendage of ventromesal lobe of gonocoxite.

a: Gonocoxite and gonostylus, dorsal view.  
b: Gonocoxite and gonostylus, mesal view.  
c: Gonostylus and gonocoxite, lateromesal view.  
d: Gonostylus and gonocoxite, dorsomesal view.  

a

b

Figure 11.

Dicranomyia (I.) intricata Alexander, male, aedeagus and parameres. aed=aedeagus, pm=paramere.

a: Ventral view.  
b: Lateral view.  

a

b

Figure 12.

Dicranomyia (I.) intricata Alexander, female, details of postabdomen.

a: Cerci and 9th sternite, inner/ventral view. tg=tergite, st=sternite, iap=infra-anal plate. Vaginal apodeme (genital fork) is a triangular, hyaline membrane behind st9, not well visible in the photo.  
b: Hypogynial valves, inner/dorsal view. hv=hypogynial valves, st=sternite.  

a

b

Figure 13.

Phylogenetic trees of Dicranomyia (Idiopyga) species and three out-group species based on COI sequences (raw data available in Suppl. material 2).

a: The single most parsimonius tree (L=622) with jackknife support on nodes.  
b: The optimal maximum likelihood tree (lnL= -3501.956818) with bootstrap support on nodes.  

Brownish, small species, very close to D. (I.) intricata. Ventrobasal lobe of ventral gonostylus sinuous, apex oval. Inner appendage of gonocoxite apically rounded. Rostral prolongantion of ventral apically rather narrow and subrostral prolongation simple, not bilobed, bearing dark stout spines. Female infra-anal plate with strong caudal peak.

Boreo (borealis, Latin)= north, baltica (Latin)= referring to the Baltic Sea. The species is so far known from the northern Baltic area. The species name is deemed to be a latinized adjective in nominative singular.

European, only known from Finland. The species is hitherto known from five separate localities; four of these are shore meadows in Oulunsalo and Hailuoto island (see Nieminen 2008), and the fifth locality is in Tornio, a rich fen ca. 12 km inland from the coast line, 15 m above sea level (Fig. 14).

Figure 14.  

Collecting sites of Dicranomyia (I.) boreobaltica Salmela sp.n. (black squares) and D. (I.) intricata Alexander (red dots) in Fennoscandia. The map was drawn by using Google Maps.

The species is probably halophilous, occurring in Baltic coastal meadows characterised by vascular plants such as Phragmites australis, Lysimachia thyrsiflora, Eleocharis palustris, Carex halophila and C. paleacea (Nieminen 2008, as D. (I.) intricata). These coastal meadows are produced by a phenomenon called land uplift, that is, the rebound of earth's crust after the retreating of the ice sheet; in the Bothnian Bay the rate of land uplift is about 8 mm/year (Rehell 2006). In addition to the meadows influenced by brackish water, the species has been collected from a calcareous rich spring fen. This rich spring fen is known to have high concentrations of e.g. Ca (53 mg/l), Na (5.3 mg/l), Fe (32 mg/l) and having high specific conductivity (42.7 mS/m), alkalinity (4.85 mmol/l) and pH (7.9, T. Sallantaus, personal communication). This spring fen is located quite close to the current shore line, and extrapolating from Okkonen 2003 (fig. 21), one may estimate that this fen was on the Baltic shore some 600-700 years ago. It may be that high concentrations of dissolved minerals in the fen resemble brackish water habitat, allowing the survival of this halophilous crane fly species. It may thus be assumed that D. (I.) boreobaltica Salmela sp.n. is a recent relict species in the fen. It should be noted that some plants typical for the Baltic shores or brackish water have isolated populations on calcareous ponds or mires far from coastal areas (e.g. Tricloghin maritima, Potamogeton filiformis, Hämet-Ahti et al. 1998)

Due to its apparent rarity, that is, small area of occupancy and extent of occurrence, the species could most likely be assessed as a threatened species according to IUCN criteria. Habitats of this species are highly endangered, usually small and isolated. There are a total of ca. 4200 ha of Baltic coastal meadows along the Finnish coast, and all such habitat types are red-listed (Schulman et al. 2008). Also spring fens are threatened habitats (Leka et al. 2008). Furthermore, Salmela (Salmela 2005) studied adult crane fly fauna of 20 springs, of which 10 were calcareous springs, only some 30–60 km northeast from Kusiaskorpi rich fen, and D. (I.) boreobaltica Salmela sp.n. was absent from the samples. This and other negative records (i.e. absence) from >500 Malaise trapping sites in Finnish wetlands (Salmela 2012, Salmela 2013, J. Salmela unpublished) indicate a very restricted range of this species. In a matter of fact, there are some endemic or highly disjunct plant (e.g. Alisma wahlenbergii, Euphrasia bottnica, Primula nutans) and insect (Elachista vonschantzi, Holopyga metallica, Macroplea pubipennis) species in the Baltic coastal areas (Hultén 1950, Dahl 1998, Mutanen 2003, Kölsch et al. 2006, Paukkunen et al. 2014). Hence, by using the above mentioned plants and insects as surrogates, D. (I.) boreobaltica Salmela sp.n. could either be i) a recently evolved allopatric species that survived Pleistocene glaciations and is currently only present in the Baltic area or ii) a disjunct species having populations in other (coastal) areas.

Based on morphology and COI sequence divergence, the new species is very closely related to the Holarctic species D. (I.) intricata. As already stated in the title of this article, the new species is cryptic, meaning that it is hard to distinguish from its sister species by morphological characters. Strictly speaking, cryptic species may mean taxa that are morphologically indisguishable (Pfenninger and Schwenk 2007, but see Tan et al. 2010), but the new species described here can be separated from its sister species by using a genetic marker (barcoding region of COI) and morphology. However, morphological differences between these two species are not great and the only reliable diagnostic characters are found from male and female genitalia. These two species are allopatric, their closest known populations lay some 180 km apart. Despite these species not being from sympatric populations, we assume that their differences are well sufficient to keep their gene pools separated even in the case of possible secondary contact. Their COI divergence or K2P distance (5 %) is far too high to be considered as an intraspecific variation among majority of other insects (e.g. Hausmann et al. 2011, Park et al. 2011) or crane flies (Pilipenko et al. 2012). Instead, intraspecific variation among insects is typically smaller than 2 % and higher COI divergence usually indicates two separate species (Mutanen et al. 2013, Pentinsaari et al. 2014). Considering morphology, there is a recent case study from Israel (Stary et al. 2012) showing that two closely related, allopatric Phyllolabis crane flies were treated as separate species although they have almost identical genitalia and the closest populations of these species live only 30 km apart. In Israel, the species were separated by a dispersal barrier (Rift Valley, Stary et al. 2012); in Fennoscandia, D. (I.) boreobaltica Salmela sp.n. and D. (I.) intricata are not separated by a distinct barrier, they have non-overlapping ranges perhaps because of biogeographic factors driven by climate (see e.g. Luoto et al. 2006, Väisänen et al. 1992) and availability of habitat (brackish water, calcareous springs in the vicinity of coast line).

External characters, such as wing venation and body coloration, between D. (I.) boreobaltica Salmela sp.n. and D. (I.) intricata are practically identical. The most important differences in male and female post-abdomen between the species are summarized in Table 2. Among other D. (Idiopyga) species, the new species is quite close to D. (I.) esbeni. Besides other details, the ventrobasal lobe of gonocoxite in D. (I.) esbeni is sinuous (see Stary 2007, fig. 1), and rather straight in D. (I.) boreobaltica Salmela sp.n. Dicranomyia (I.) melleicauda complicata de Meijere is also quite close to the new species, but has rather stout iagx and apically wide lvg (see de Meijere 1919, plates 5-6). Males of other species are easily separated from the new species based on differences in the stucture of hypopygium. Considering females, we refrain from further discussion due to the lack of comparative material.

Standard 5′ region (658 bp) of the cytochrome c oxidase I (COI) sequence of Dicranomyia (I.) boreobaltica Salmela sp.n. BOLD Sample ID JES-20120094, holotype specimen:

TACCTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTGGGAACTTCATTAAGTATTATTATTCGAGCAGAATTAGGACACCCAGGTGCATTAATTGGAGACGACCAGATTTATAATGTGGTAGTTACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTTCCCCCTTCTTTAACTTTATTATTAGCTAGAAGCATAGTTGAAAACGGGGCAGGAACTGGCTGAACAGTATACCCTCCCCTTTCTTCTGGAATTGCCCATTCAGGGGCTTCTGTAGATTTAGCTATTTTTTCTCTTCACCTAGCAGGTATTTCTTCTATTTTAGGAGCTGTTAATTTTATTACAACTGTTATTAATATACGTTCAGCAGGAATTTCATTTGATCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTATTTTATTGCTTTTATCACTTCCTGTTTTAGCCGGAGCTATTACAATATTATTAACAGATCGAAACTTAAATACTTCATTTTTTGATCCCGCAGGTGGAGGAGACCCTATTTTATATCAGCATTTATTT

Based on K2P (Kimura 1980) distances, the new species is closest to D. (I.) intricata (K2P distance 5.13 %), D. (I.) esbeni (7.16 %) and D. (I.) magnicauda (9.51 %); other distances within examined D. (Idiopyga) species range between 10.76 and 15.70 %.

Dicranomyia intricata Alexander 1927: 221 (original description)

Limonia (Dicranomyia) suecica Nielsen 1953: 34 (original description)

Limonia (Dicranomyia) suecica Tjeder 1958: 160 (distribution, figure of hypopygium on p. 157)

Dicranomyia (Idiopyga) intricata Salmela 2011b: 224 (distribution, ecology)

The holotype specimen of D. (I.) intricata (Fig. 7a) is in good condition, dry and pinned, hypopygium is not detached. Alexander (Alexander 1927, fig. 1) permanently slide-mounted and illustrated his paratype specimen (Fig. 7b). The holotype of Dicranomyia suecica Nielsen was re-described and well illustrated by Tjeder (Tjeder 1958) and the species was proposed as a synonym of D. (I.) intricata by Savchenko et al. 1992. Unfortunately the male hypopogiym of D. suecica is lost (T. Pape, personal communication), but based on Tjeder's detailed illustrations this nomenclature can be verified. Alexander's original description is good, and there is no need to thoroughly re-describe this species. However, male and female genitalia are illustrated here and diagnostic characters are discussed under D. (I.) boreobaltica Salmela sp.n.

Male hypopygium. 9th tergite and proctiger as in Fig. 8. Gonocoxite dark brown, sparsely covered with dark setae. Ventromesal lobe of gonocoxite as in Fig. 9. The main lobe (lgx) club-like, straight and elongated, apex beak-like, having medially patch of hyaline curly setae (Fig. 9). The appendage of ventromesal lobe (algx) as in Fig. 9. Inner appendage of gonocoxite (iagx, Fig. 10a, b, c) sclerotized, curved, apically with a number of stout, short setae; apex of iagx bilobed. Structure of gonostylus as in D. (I.) boreobaltica Salmela sp.n., see Fig. 10a, b, c. Ventrobasal lobe of ventral gonostyle (lvg) tail-like, slightly sinuous, weakly sclerotized, having patches of hyaline setae both basally and apically; its stalk narrowing toward apex; apex of lvg spherical (Fig. 9). Rostrum (rm) light brown, apically widest, bearing two strong spines (Fig. 10a). Subrostral prolongation of ventral gonostyle (srm) strongly sclerotized, bilobed, very robust, approximately as long as rm, almost parallel with rm; srm with number of median and subapical stout black spines, apical spines are hyaline/light brown (Fig. 10b, c, d). Ventral surface of aedeagus bearing hyaline setosity, lateral margins of parameres rather strongly serrated (Fig. 11). See also Suppl. material 1.

Female postabdomen. Cerci and hypogynial valves, see Fig. 12.

Holarctic. Known from Canada (Alberta, Northwest territories, British Columbia), Sweden (North Sweden, Abisko, Nielsen 1953, Tjeder 1958) and Finland. In Finland D. (I.) intricata is known from the north boreal ecoregion, both from the zone of coniferous forests and from the subarctic fell area in the northernmost part of the country (Fig. 14

The original description of D. (I.) intricata (Alexander 1927) was based on material collected from "Muskeg" bogs. Muskegs are nutrient poor peatlands dominated by Sphagnum mosses (http://en.wikipedia.org/wiki/Muskeg). Most of the Finnish sampling sites are aapamires, that is, minerotrophic fens with wet, usually moss covered, flarks (hollows) and drier hummock-level strings. Most of the sites are intermediate rich or rich fens, characterised by brown mosses (e.g. Warnstorffia, Scorpidium, Paludella). The species was especially abundant on two closely lying intermediate rich, Sphagnum dominated aapamires in Enontekiö, NW Finnish Lapland, but single specimens were also caught along a spring and a headwater stream (Salmela 2011a). The species is on the wing from mid August to early September.

Dicranomyia (I.) intricata is red-listed in Finland (NT, Penttinen et al. 2010). At the time of the assessment, it was not known that D. (I.) intricata is absent from the northern Baltic coastal area and is replaced there by a sibling species (D. (I.) boreobaltica sp.n. Salmela). Thus the range ("extent of occurrence") of D. (I.) intricata is actually smaller that was thought in the 2010 assessment. However, the species is not extremely rare and there are most likely hundreds of square kilometres of suitable breeding sites for the species in Finnish Lapland. Nevertheless, the species may be jeopardized by climate change and it may also be used as an indicator of pristine boreal mires.

See Dicranomyia (I.) boreobaltica Salmela sp.n.

Standard 5′ region (658 bp) of the cytochrome c oxidase I (COI) gene of Dicranomyia (I.) intricata (BOLD Sample IDs JES-20120082 and JES-20110082, identical specimens):

TACCTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCACTAAGTATTATTATTCGAGCAGAATTAGGACACCCAGGAGCATTAATTGGAGATGACCAAATTTATAATGTAGTAGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTCGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTTCCCCCTTCTTTAACCTTATTATTAGCTAGAAGTATAGTTGAAAACGGGGCAGGAACTGGTTGAACAGTTTACCCTCCCCTTTCTTCTGGAATTGCTCATTCAGGAGCTTCTGTAGACTTAGCTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTGTTAACTTTATTACAACTGTTATTAATATACGTTCAGCAGGAATTTCATTCGACCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTATTCTATTACTCTTATCACTCCCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGAAACTTAAACACTTCATTTTTTGACCCTGCAGGTGGAGGAGATCCTATTTTATACCAACACTTATTT