1 urn:lsid:arphahub.com:pub:F9B2E808-C883-5F47-B276-6D62129E4FF4 urn:lsid:zoobank.org:pub:245B00E9-BFE5-4B4F-B76E-15C30BA74C02 Biodiversity Data Journal BDJ 1314-2836 1314-2828 Pensoft Publishers 10.3897/BDJ.12.e129214 129214 25203 Taxonomy & Inventories Chordata Ranidae Animalia Amphibia Anura Vertebrata Systematics Taxonomy Phylogeny Central Asia China Asia Taxonomic relationship between Amolops minutus Orlov & Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, with first record of A. minutus from China (Anura, Ranidae) Liu Shuo https://orcid.org/0000-0001-7825-3006 1 Nguyen Truong Quang https://orcid.org/0000-0002-6601-0880 2 3 Le Minh Duc https://orcid.org/0000-0002-2953-2815 4 5 6 Pham Cuong The 2 3 Pham Anh Van 4 Hou Mian 7 Zhou Hongxin https://orcid.org/0009-0004-9801-8811 8 Mo Mingzhong 9 Li Mei 10 Li Biao 10 Luo Xiong 10 Rao Dingqi raodq@mail.kiz.ac.cn 8 Li Song lis@mail.kiz.ac.cn 1 11 Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences Kunming China Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology, Hanoi, Vietnam Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology Hanoi Vietnam Graduate University of Science and Technology, Vietnam Academy of Science and Technology, Hanoi, Vietnam Graduate University of Science and Technology, Vietnam Academy of Science and Technology Hanoi Vietnam Faculty of Environmental Sciences, University of Science, Vietnam National University, Hanoi, Vietnam Faculty of Environmental Sciences, University of Science, Vietnam National University Hanoi Vietnam Central Institute for Natural Resources and Environmental Studies, Vietnam National University, Hanoi, Vietnam Central Institute for Natural Resources and Environmental Studies, Vietnam National University Hanoi Vietnam Department of Herpetology, American Museum of Natural History, New York, United States of America Department of Herpetology, American Museum of Natural History New York United States of America College of Continuing (Online) Education, Sichuan Normal University, Chengdu, China College of Continuing (Online) Education, Sichuan Normal University Chengdu China Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China Kunming Institute of Zoology, Chinese Academy of Sciences Kunming China Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province, Mengzi, China Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province Mengzi China Guanyinshan Provincial Nature Reserve Management and Protection Bureau, Yuanyang, China Guanyinshan Provincial Nature Reserve Management and Protection Bureau Yuanyang China Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences Kunming China

Corresponding authors: Dingqi Rao (raodq@mail.kiz.ac.cn), Song Li (lis@mail.kiz.ac.cn).

Academic editor: Bin Wang

 2024 26 09 2024 12 e129214 3632FEAB-98DE-5B4A-8C87-CF8EE959B62A 07 06 2024 18 09 2024 Shuo Liu, Truong Quang Nguyen, Minh Duc Le, Cuong The Pham, Anh Van Pham, Mian Hou, Hongxin Zhou, Mingzhong Mo, Mei Li, Biao Li, Xiong Luo, Dingqi Rao, Song Li This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Background

Based on the examination of specimens of Amolops minutus Orlov & Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, we found that there is no significant morphological difference between them. Phylogenetic analysis also showed that A. minutus and A. ottorum belong to the same taxon. In addition, we discovered the distribution of A. minutus in China.

 New information

In this study, we provide the first molecular data of Amolops minutus and regard A. ottorum as a junior synonym of A. minutus. In addition, we report the first record of A. minutus from China, based on nine specimens collected from Guanyinshan Provincial Nature Reserve in southern Yunnan Province and present an updated diagnosis of this species, based on literature data and newly-collected specimens.

 16S Guanyinshan Provincial Nature Reserve morphology synonym taxonomy torrent frogs Introduction

The torrent frogs of Amolops Cope, 1865 inhabits torrents or waterfalls and they usually have an abdominal sucker in larvae and enlarged digital discs in adults (Fei et al. 2009, Fei et al. 2012). This genus is distributed broadly from southern and eastern Himalayas to Peninsular Malaysia (Dever et al. 2012, Pham et al. 2019, Wu et al. 2020, Mahony et al. 2022, Tang et al. 2023, Li et al. 2024, Frost 2024). It currently contains 86 recognised species (Frost 2024) and they are placed into ten species groups, namely the A. chayuensis group, A. daiyunensis group, A. hainanensis group, A. larutensis group, A. mantzorum group, A. marmoratus group, A. monticola group, A. ricketti group, A. spinapectoralis group and A. viridimaculatus group (Jiang et al. 2021, Wu et al. 2024).

The Amolops mantzorum group currently comprises twelve species, namely A. ailao Tang, Sun, Liu, Luo, Yu & Du, 2023, A. dafangensis Li, Liu, Ke, Cheng & Wang, 2024, A. granulosus (Liu & Hu, 1961), A. jinjiangensis Su, Yang & Li, 1986, A. lifanensis (Liu, 1945), A. loloensis (Liu, 1950), A. mantzorum (David, 1872), A. minutus Orlov & Ho, 2007, A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, A. sangzhiensis Qian, Xiang, Jiang, Yang & Gui, 2023, A. shuichengnicus Lyu & Wang, 2019 and A. tuberodepressus Liu & Yang, 2000 (Tang et al. 2023, Li et al. 2024).

Amolops minutus was described by Orlov and Ho (2007), based on morphological characteristics from Tam Duong District, Lai Chau Province, Vietnam, and molecular data of the species is unavailable. Amolops ottorum was discovered by Pham et al. (2019), based on two female specimens from Muong La District, Son La Province, Vietnam. The type localities of both species are located in north-western Vietnam and they are approximately 90 km distant from each other.

During our fieldwork in northern Vietnam, we collected fifteen specimens of Amolops minutus from its type locality in Lai Chau Province. As these specimens morphologically resemble A. ottorum, we suspected that these two species may be conspecific. To confirm their taxonomic status, we sequenced the homologous gene of the topotypic specimens of A. minutus and the type specimens of A. ottorum and phylogenetic analysis supported that they are conspecific with a genetic divergence of 0.7% (16S gene). Morphological examination of the type specimens of A. minutus showed that the original description of the species was not very accurate and there was no significant morphological difference between A. minutus and A. ottorum. According to the order of naming time, we herein consider A. ottorum as a junior synonym of A. minutus. In addition, we recently collected nine specimens of Amolops from Guanyinshan Provincial Nature Reserve in Yunnan Province, China. The sequences of these specimens clustered with those of the topotypic specimens of A. minutus. We herein report the record of A. minutus from China for the first time.

 Materials and methods

Field surveys were conducted in Lai Chau Province, northern Vietnam, in 2020 and in Guanyinshan Provincial Nature Reserve, Yunnan Province, China, in 2023 and 2024. Voucher specimens collected from Vietnam were deposited at the Institute of Ecology and Biological Resources (IEBR), Hanoi, Vietnam and specimens collected from China were deposited at Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ), Kunming, China.

Measurements were taken with a digital caliper to the nearest 0.1 mm. The following morphological characteristics were used: snout-vent length (SVL), from the tip of the snout to the cloacal; head length (HL), from the rear of the lower jaw to the tip of the snout; head width (HW), at the greatest cranial width; snout-eye distance (ESL), from the tip of the snout to the anterior corner of the eye; eye diameter (ED), horizontal diameter of the eye; tympanum diameter (TD), horizontal diameter of the tympanum; fore-limb length (FLL), from the tip of the disc of the third finger to the axilla; hind-limb length (HLL), from the tip of the disc of the fourth toe to the groin; tibia length (TL), from the knee to the tarsus; foot and tarsus length (FOT), from the tip of the disc of the fourth toe to the posterior edge of the tibia.

Total genomic DNA was extracted from tissues. A fragment of the 16S ribosomal RNA (16S) gene was amplified and sequenced. The primer pairs L2188: 5’–AAAGTGGGCCTAAAAGCAGCCA–3’ and 16H1: 5’–CTCCGGTCTGAACTCAGATCACGTAGG–3’ (Hedges 1994, Matsui et al. 2006) and 16SAR: 5’-CGCCTGTTTAYCAAAAACAT-3’ and 16SBR: 5’-CCGGTYTGAACTCAGATCAYGT-3’ (Simon et al. 1994) were used in polymerase chain and cycling reactions. All newly-generated sequences have been deposited in GenBank and homologous sequences of other Amolops species were obtained from GenBank (Table 1).

Sequences were aligned using MAFFT 7.471 (Katoh and Standley 2013). The best fit substitution models were selected for Bayesian inference (BI) and maximum likelihood (ML) analyses, respectively, using the corrected Akaike Information Criterion (AICc) in ModelFinder (Kalyaanamoorthy et al. 2017). Bayesian inference was performed in MrBayes 3.2.7 (Ronquist et al. 2012) using the GTR+F+I+G4 model. Markov chains were run for 5,000,000 generations and sampled every 100 generations. The first 25% of the sampled trees was discarded as burn-in and the remaining trees were used to estimate Bayesian posterior probabilities (BPPs). Maximum likelihood analysis was performed in IQ-TREE 1.6.12 (Nguyen et al. 2015) with the TIM2+F+I+G4 model. Branch support was assessed using 5,000 ultrafast bootstrap replicates (UFB). The values of BPPs and UFB ≥ 95% are considered strong support for a clade (Ronquist et al. 2012, Nguyen et al. 2015). The uncorrected pairwise distances between species were calculated in MEGA 11 (Tamura et al. 2021).

 Taxon treatments 605428C5-FBCE-5ABC-9C40-3708D5821590Amolops minutus Orlov & Ho, 2007 Materials

Type status: Other material. Occurrence: catalogNumber: IEBR A.5142; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: D85CF383-2685-58BF-B761-02FA97632765; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5143; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 220E4937-E84B-5FA0-B0DE-88D8039C4940; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5144; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: B1C10D49-59B9-5180-9D18-54C1BC04E812; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5145; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 24C4943D-F3CA-5BF0-B133-87C5CB7A1603; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5146; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5CEB76ED-5893-519D-9452-E3D31153B175; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5147; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: C23C4993-DBF6-512A-BA1F-007CFABBA6BA; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5148; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 9319A5D0-DB68-5859-BD38-3E0623489A2C; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5149; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: FD7307D9-575F-559F-B23E-5A7DBC70CC7B; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.5150; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 0F19C455-DBF5-5A49-9C5C-B047533698E6; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6299; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 14D431C9-4554-500C-BD95-364B33E742E2; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6300; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: AF82375D-18FF-54D1-B211-8AC61B87CF47; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6301; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: F4EB3970-70D7-5F67-8EFA-6A5734985252; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6302; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: B11DEB88-8877-5909-AC5D-806099C697B0; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6303; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 7B75B4E5-270B-5227-9928-67B20CB682FB; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: IEBR A.6304; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: B7189F6D-EFF6-5110-A7B6-DE4DBB8C2E2E; Taxon: scientificName: Amolops minutus; Location: country: Vietnam; stateProvince: Lai Chau; locality: Ho Thau Village, Ho Thau Commune, Tam Duong District; verbatimElevation: 2440 m; verbatimCoordinates: 22°24′42″N 103°36′35″E; Event: eventRemarks: collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023064; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 518014E8-3FCE-56F9-B84A-BC2D935425CA; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023065; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 0FC83528-7760-5F20-84F7-3B4465EEECBD; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023066; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 89044FE6-F2FA-5991-9BC8-A22EBEFFDD45; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023067; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: DFC7F447-5B74-5FFD-9254-C729C75CC841; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023068; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: DC4AB2B4-70F8-516E-A561-24B34E657C26; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023069; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2467D2C6-A15C-5EE0-8C7E-B63F9F489211; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023070; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: FDAC765F-29ED-5487-9B51-46F6331679CF; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2410 m; verbatimCoordinates: 23°0'57"N 102°56'57"E; Event: eventRemarks: collected by Shuo Liu on 16 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2023102; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: A891C6DE-2573-5D59-A021-CE1C3EA24FD3; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Xiaoxinjie Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2490 m; verbatimCoordinates: 22°59'20"N 102°59'26"E; Event: eventRemarks: collected by Shuo Liu on 20 May 2023; Record Level: basisOfRecord: preserved specimen

Type status: Other material. Occurrence: catalogNumber: KIZ 2024112; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: F47A3080-9562-550A-B16F-1828B9EA9F16; Taxon: scientificName: Amolops minutus; Location: country: China; stateProvince: Yunnan; locality: Ganiang Township, Yuanyang County, Honghe Prefecture; verbatimElevation: 2200 m; verbatimCoordinates: 23°2'54"N 102°54'45"E; Event: eventRemarks: collected by Shuo Liu on 13 April 2024; Record Level: basisOfRecord: preserved specimen

 Extended diagnosis

This species is assigned to the Amolops mantzorum species group on the basis of the absence of a dorsolateral fold and the absence of circum-marginal groove on the disc of the first finger. It is distinguishable from other members of this species group by a combination of the following morphological characters: size small (SVL 29.7–38.3 mm in adult males and 38.5–51.1 mm in adult females); head moderate large, longer than wide (HL/SVL 0.33–0.37 in males and 0.31–0.35 in females, HW/SVL 0.28–0.33 in males and 0.26–0.32 in females); tympanum distinct, small (TD/HL 0.10–0.23 in males and 0.09–0.27 in females); pineal spot present; pupil oval, horizontal; vomerine teeth absent or weakly developed; vocal sac absent in males; fore-limbs robust (FLL/SVL 0.70–0.87 in males and 0.67–0.85 in females), relative finger lengths I < II < IV < III; hind-limbs long (HLL/SVL 1.79–2.09 in males and 1.70–2.00 in females), relative toe length I < II < III < V < IV; dorsal skin smooth, with a few flattened tubercles on flanks and posterior surface of dorsum; supratympanic fold absent or weakly developed; true dorsolateral folds absent, but dorsolateral glandular folds distinct; circummarginal groove on tip of first finger absent; inner metatarsal tubercle small; outer metatarsal tubercle absent; nuptial pad present on finger I of adult males. Colour of dorsal surface from nearly uniform green to mostly brown, flanks mostly green, dark bars on dorsal limbs distinct or indistinct.

 Distribution

Amolops minutus is currently known from Lai Chau and Son La provinces in northern Vietnam and Guanyinshan Provincial Nature Reserve in Yuanyang County, Honghe Prefecture, Yunnan Province, China (Fig. 1).

 Analysis

Morphological characteristics of the specimens collected from the type locality of Amolops minutus in Lai Chau Province (Vietnam) were similar to those in the original description of Orlov and Ho (2007), except for the vomerine teeth which were absent or weakly developed and the gular pouches being absent in males (vs. vomerine teeth strongly developed and paired gular pouches present in males in the original description) and small variations in the relative size of the tympanum and the relative length of the fore-limbs (Table 2). However, we found that the type specimens of A. minutus have no vomerine teeth or only weakly-developed vomerine teeth and no gular pouches in males (Fig. 2), which were not as described in Orlov and Ho (2007).

Moreover, morphological comparison showed that the type specimens of A. ottorum from Son La Province (Vietnam) and the newly-collected specimens of Amolops from Yunnan Province (China) are very similar to A. minutus (Table 2).

The newly-generated sequences are approximately 850 bp or 570 bp. BI and ML analyses yielded similar results. The sequences of the type specimens of Amolops ottorum from Son La Province (Vietnam), the specimens collected from the type locality of A. minutus in Lai Chau Province (Vietnam) and the Amolops specimens collected from Yunnan Province (China), clustered in the same clade with strong support by both BI and ML (BPPs = 1, UFB = 96) (Fig. 3). The uncorrected pairwise distance between the sequences of the type specimens of A. ottorum and the specimens collected from the type locality of A. minutus was 0.7% and the uncorrected pairwise distance between the sequences of the Amolops specimens collected from Yunnan and the specimens collected from the type locality of A. minutus was 0.6% (Table 3).

Based on morphological data and phylogenetic analysis, we assign the specimens collected from the type locality of A. minutus in Lai Chau Province (Vietnam) and from Yunnan Province (China) to A. minutus and regard A. ottorum as a junior synonym of A. minutus.

 Discussion

As some discrepancies between the morphological characters of the specimens we collected from the type locality of Amolops minutus and the original descriptions of this species, in order to verify whether the specimens we collected belong to A. minutus, we rely on the type specimen of this species. Re-examination of the type specimens verified that the specimens collected from the type locality A. minutus belong to A. minutus. In addition, morphological comparison between the type specimens of A. ottorum and the type and topotypic specimens of A. minutus showed that these two species could not be clearly distinguished. Combined with phylogenetic analysis, we confirmed that A. ottorum and A. minutus are conspecific and A. ottorum should be regarded as a junior synonym of A. minutus. Moreover, we found that A. minutus is also distributed in China and the colouration of this species in life was quite variable (Fig. 4), which extends the distribution range and diagnosis of this species.

Guanyinshan Provincial Nature Reserve is located in southern Yunnan Province of China, with relatively high altitudes (approximately 1640–2746 m) and well-preserved natural habitat. There have been few previous field surveys in this nature reserve, resulting in a serious underestimation of its species diversity. Some new species of plants and animals have been discovered in this nature reserve recently, such as Primula weimingii Bin Yang & Y.H. Tan and Pareas guanyinshanensis Liu, Mo, Li, Li, Luo, Rao & Li, 2024 (Yang et al. 2023, Liu et al. 2024). The discovery of Amolops minutus in this nature reserve further enriches its species diversity. More field surveys will likely reveal more new species or new records of amphibians from this nature reserve.

 Acknowledgements

We thank the forest rangers of Guanyinshan Provincial Nature Reserve for their assistance in the fieldwork. We are grateful to the directorates of the Forest Protection Department of Lai Chau Province and Tam Duong District for supporting our fieldwork. We thank C. V. Hoang, T. Q. Phan (Ha Noi) and N. B. Sung (Son La) for their assistance in the field. We express our gratitude to T. T. Nguyen (Institute of Genome Research, VAST) and Nikolai Orlov (Zoological Institute, Russian Academy of Sciences) for sharing information and loan of type specimens. We would like to thank the editors and reviewers for their valuable comments on the manuscript. This work was supported by the project of Yuanyang Guanyin Mountains Provincial Nature Reserve Integrative Scientific Expedition (grant no. E2HX105B), the Position of Bioclassonomist of Chinese Academy of Sciences (grant no. CAS-TAX-24-055), the National Natural Science Foundation Project: Classificatory and Phylogenetic Studies on the Amolops frogs of China (grant no. NSFC-31772424), the Small Grants Programme by the ASEAN Centre for Biodiversity II (Small-grant in the Hoang Lien National Park) under Grant Number 2023 VNM HLNP 11 to A.V. Pham and the project of the Ministry of Ecology and Environment of China: Investigation and assessment of amphibians and reptiles in southern Yunnan.

 References Dever Jennifer A. Fuiten Allison M. Konu Özlen Wilkinson Jeffery A. 2012 Cryptic torrent frogs of Myanmar: An examination of the Amolops marmoratus species complex with the resurrection of Amolops afghanus and the identification of a new species Copeia 2012 1 57 76 10.1643/ch-10-180 Fei Liang Hu Shuqin Ye Changyuan Huang yongzhao 2009 Fauna Sinica. Amphibia Vol. 2 Anura Science Press Beijing 9787030232700 Fei Liang Ye Changyuan Jiang Jianping 2012 Colored atlas of Chinese amphibians and their distributions Sichuan Publishing House of Science & Technology Chengdu 9787536475458 Frost Darrel Amphibian species of the world: an online reference. Version 6.1. http://research.amnh.org/herpetology/amphibia/index.html 2024-06-02T00:18:30+00:00 Hedges S 1994 Molecular evidence for the origin of birds Proceedings of the National Academy of Sciences 91 7 2621 2624 10.1073/pnas.91.7.2621 Jiang Ke Ren Jionglong Lyu Zhingtong Wang Dan Wang Zeng Lv Ke Wu Jiawei Li Jiatang 2021 Taxonomic revision of Amolops chunganensis (Pope, 1929) (Amphibia: Anura) and description of a new species from southwestern China, with discussion on Amolops monticola group and assignment of species groups of the genus Amolops Zoological Research 42 5 574 591 10.24272/j.issn.2095-8137.2021.107 Kalyaanamoorthy Subha Minh Bui Wong Thomas von Haeseler Arndt Jermiin Lars 2017 ModelFinder: fast model selection for accurate phylogenetic estimates Nature Methods 14 6 587 589 10.1038/nmeth.4285 Katoh K. Standley D 2013 MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability Molecular Biology and Evolution 30 4 772 780 10.1093/molbev/mst010 Li Shize Liu Jing Ke Xiaocong Cheng Gang Wang Bin 2024 A new species of Amolops (Amphibia, Anura, Ranidae) from Guizhou Province, China ZooKeys 1189 33 54 10.3897/zookeys.1189.115621 Liu Shuo Mo Mingzhong Li Mei Li Biao Luo Xiong Rao Dingqi Li Song 2024 Description of a new species of the Pareas hamptoni complex from Yunnan, China, with confirmation of P. hamptoni sensu stricto in China (Squamata, Pareidae) Animals 14 421 10.3390/ani14030421 Mahony S Nidup T Streicher J Teeling E Kamei R 2022 A review of torrent frogs (Amolops: Ranidae) from Bhutan, the description of a new species, and reassessment of the taxonomic validity of some A. viridimaculatus group species aided by archival DNA sequences of century-old type specimens The Herpetological Journal 32 3 142 175 10.33256/32.3.142175 Matsui Masafumi Shimada Tomohiko Liu Wanzhao Maryati Mohamed Khonsue Wichase Orlov Nikolai 2006 Phylogenetic relationships of Oriental torrent frogs in the genus Amolops and its allies (Amphibia, Anura, Ranidae) Molecular Phylogenetics and Evolution 38 3 659 666 10.1016/j.ympev.2005.11.019 Nguyen Lam Schmidt Heiko von Haeseler Arndt Minh Bui 2015 IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies Molecular Biology and Evolution 32 1 268 274 10.1093/molbev/msu300 Orlov NL Ho CT 2007 Two new species of cascade ranids of Amolops genus (Amphibia: Anura: Ranidae) from Lai Chau Province (northwest Vietnam) Russian Journal of Herpetology 14 3 211 228 10.30906/1026-2296-2007-14-3-211-228 Pham Anh Sung Nenh Pham Cuong Le Minh Ziegler Thomas Nguyen Truong 2019 A new species of Amolops (Anura: Ranidae) from Vietnam The Raffles Bulletin of Zoology 67 363 377 10.5281/zenodo.4576230 Ronquist Fredrik Teslenko Maxim van der Mark Paul Ayres Daniel Darling Aaron Höhna Sebastian Larget Bret Liu Liang Suchard Marc Huelsenbeck John 2012 MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space Systematic Biology 61 3 539 542 10.1093/sysbio/sys029 Simon Chris Frati Francesco Beckenbach Andrew Crespi Bernie Liu Hong Flook Paul 1994 Evolution, Weighting, and Phylogenetic Utility of Mitochondrial Gene Sequences and a Compilation of Conserved Polymerase Chain Reaction Primers Annals of the Entomological Society of America 87 6 651 701 10.1093/aesa/87.6.651 Tamura Koichiro Stecher Glen Kumar Sudhir 2021 MEGA11: Molecular Evolutionary Genetics Analysis Version 11 Molecular Biology and Evolution 38 7 3022 3027 10.1093/molbev/msab120 Tang Shangjing Sun Tao Liu Shuo Luo Sangdi Yu Guohua Du Lina 2023 A new species of cascade frog (Anura: Ranidae: Amolops) from central Yunnan, China Zoological Letters 9 15 10.1186/s40851-023-00214-9 Wu Yun-He Yan Fang Stuart Bryan Prendini Elizabeth Suwannapoom Chatmongkon Dahn Hollis Zhang Bao-Lin Cai Hong-Xia Xu Yong-Biao Jiang Ke Chen Hong-Man Lemmon Alan Lemmon Emily Raxworthy Christopher Orlov Nikolai Murphy Robert Che Jing 2020 A combined approach of mitochondrial DNA and anchored nuclear phylogenomics sheds light on unrecognized diversity, phylogeny, and historical biogeography of the torrent frogs, genus Amolops (Anura: Ranidae) Molecular Phylogenetics and Evolution 144 106701 1 13 10.1016/j.ympev.2020.106789 Wu Yun-He Yu Zhong-Bin Lu Chen-Qi Zhang Yin-Peng Dong Wen-Jie Liu Xiao-Long Kilunda Felista-Kasyoka Xiong Yun Jiang Yun-Fang Ouyang Hong Fu Zhong-Xiong He Yun-Biao Yuan Zhi-Yong Che Jing 2024 A new species of the genus Amolops (Amphibia: Ranidae) and the first national record of Amolops vitreus from China Vertebrate Zoology 74 343 357 10.3897/vz.74.e108013 Yang B Zuo Y Li M Quan D Wang L Zhou S He G Tan Y 2023 Primula weimingii (Primulaceae), a new species from Yunnan, China Taiwania 68 4 435 438 10.6165/tai.2023.68.435 67890791-6BDB-5E87-B1A7-B525ACF4450A 10.3897/BDJ.12.e129214.figure1

Map showing the type locality (black star) of Amolops minutus in Lai Chau Province, Vietnam, the type locality (black triangle) of Amolops ottorum in Son La Province, Vietnam and the collection site (black dot) of the specimens from Guanyinshan Provincial Nature Reserve in Yuanyang County, Honghe Prefecture, Yunnan Province, China.

https://binary.pensoft.net/fig/1129951 0C432151-31EC-5DF4-BFE1-F33B55183435 10.3897/BDJ.12.e129214.figure2

Dorsal view (A), ventral view (B), close-up view the gular region (C) and close-up view of the upper oral wall (D) of the paratype (ZISP 7615) of Amolops minutus; and dorsal view (E), ventral view (F), close-up view the gular region (G) and close-up view of the upper oral wall (H) of the topotypic specimen (IEBR A.5142) of A. minutus.

https://binary.pensoft.net/fig/1129949 1F806B1E-506C-5001-849A-79CAB6C854E9 10.3897/BDJ.12.e129214.figure3

Bayesian phylogram of the Amolops mantzorum group inferred from the 16S rRNA sequences. Numbers after and behind “/” are BPPs and UFB values (only above 0.90/90 are shown), respectively.

https://binary.pensoft.net/fig/1129950 9F4258CB-5DC0-5D20-87D1-891DFE946A88 10.3897/BDJ.12.e129214.figure4

The specimens of Amolops minutus in life. A, the male topotypic specimen (IEBR A.5142); B, the female topotypic specimen (IEBR A.6300); C, the male specimen (KIZ 2024112) from China; D, the male specimen (KIZ 2023067) from China; E, the male specimen (KIZ 2023066) from China; F, the female specimen (KIZ 2023070) from China.

https://binary.pensoft.net/fig/1129952

Sequences (16S) used for molecular analyses in this study.

Species Voucher Locality Accession number
Amolops ailao GXNU YU000001 Xinping, Yunnan, China MN650751
Amolops ailao GXNU YU000002 Xinping, Yunnan, China MN650752
Amolops ailao GXNU YU000003 Xinping, Yunnan, China MN650753
Amolops ailao GXNU YU000004 Xinping, Yunnan, China MN650754
Amolops ailao GXNU YU20160273 Xinping, Yunnan, China MN650755
Amolops ailao GXNU YU20160274 Xinping, Yunnan, China MN650756
Amolops ailao KIZ 2022041 Xinping, Yunnan, China OP879227
Amolops dafangensis MT DF20230601002 Dafang, Guizhou, China OR936315
Amolops dafangensis MT DF20230601001 Dafang, Guizhou, China OR936314
Amolops dafangensis MT DF20230601003 Dafang, Guizhou, China OR936316
Amolops dafangensis MT DF20230601004 Dafang, Guizhou, China OR936317
Amolops dafangensis MT DF20230601005 Dafang, Guizhou, China OR936318
Amolops granulosus SYS a005315 Hongya, Sichuan, China MK604850
Amolops granulosus SYS a005316 Hongya, Sichuan, China MK604851
Amolops granulosus 20130258 Hongya, Sichuan, China MH922934
Amolops jinjiangensis SCUM 050435CHX Deqing, Yunnan, China EF453741
Amolops jinjiangensis CIB-XM6120 Deqing, Yunnan, China MZ292455
Amolops jinjiangensis KIZ 047095 Chuxiong, Yunnan, China MN953701
Amolops lifanensis SYS a005378 Lixian, Sichuan, China MK604870
Amolops loloensis SYS a005351 Zhaojue, Sichuan, China MK573806
Amolops loloensis SYS a005346 Zhaojue, Sichuan, China MK604854
Amolops loloensis SYS a005347 Zhaojue, Sichuan, China MK604855
Amolops mantzorum SYS a005366 Baoxing, Sichuan, China MK604862
Amolops mantzorum SYS a005362 Baoxing, Sichuan, China MG991893
Amolops mantzorum SYS a005336 Hongya, Sichuan, China MK573804
Amolops minutus IEBR A.5142 Tam Duong, Lai Chau, Vietnam PQ346023
Amolops minutus IEBR A.6300 Tam Duong, Lai Chau, Vietnam PQ346024
Amolops minutus IEBR 4342 (Holotype of A. ottorum) Muong La, Son La, Vietnam PQ346025
Amolops minutus TBU 06 (Paratype of A. ottorum) Muong La, Son La, Vietnam PQ346026
Amolops minutus KIZ 2023064 Yuanyang, Yunnan, China PQ346027
Amolops minutus KIZ 2023065 Yuanyang, Yunnan, China PQ346028
Amolops minutus KIZ 2023066 Yuanyang, Yunnan, China PQ346029
Amolops minutus KIZ 2023067 Yuanyang, Yunnan, China PQ346030
Amolops minutus KIZ 2023068 Yuanyang, Yunnan, China PQ346031
Amolops minutus KIZ 2023069 Yuanyang, Yunnan, China PQ346032
Amolops minutus KIZ 2023070 Yuanyang, Yunnan, China PQ346033
Amolops minutus KIZ 2023102 Yuanyang, Yunnan, China PQ346034
Amolops sangzhiensis CSUFT 901 Sangzhi, Hunan, China OQ079538
Amolops sangzhiensis CSUFT 905 Sangzhi, Hunan, China OQ079539
Amolops sangzhiensis CSUFT 907 Sangzhi, Hunan, China OQ079540
Amolops shuichengicus SYS a004956 Shuicheng, Guizhou, China MK604845
Amolops shuichengicus SYS a004957 Shuicheng, Guizhou, China MK604846
Amolops tuberodepressus CIB-XM3125 Jingdong, Yunnan, China KR559270
Amolops tuberodepressus YU20160272 Xinping, Yunnan, China MN650757
Amolops tuberodepressus SYS a003931 Jingdong, Yunnan, China MG991904
Amolops viridimaculatus SYS a003813 Mt. Gaoligong, Yunnan, China MK604836

Comparisons amongst the type specimens of Amolops minutus, the topotypic specimens of A. minutus, the type specimens of A. ottorum and the specimens of A. minutus collected from China. Measurements in mm. Abbreviations defined in the text. Data for the type specimens of A. minutus and A. ottorum were from the original descriptions (Orlov and Ho 2007; Pham et al. 2019).

Types of Amolops minutus Topotypes of Amolops minutus Types of Amolops ottorum Amolops minutus from China
Males (n = 8) Females (n = 5) Males (n = 8) Females (n = 7) Females (n = 2) Males (n = 6) Females (n = 3)
SVL 29.7–36.4 38.5–50.2 30.8–34.0 42.5–47.5 47.5–48.2 34.6–38.3 46.7–51.1
HL 11.0–12.9 12.5–15.7 10.8–12.0 14.3–16.0 15.1–16.0 12.2–13.6 16.0–17.1
HW 9.7–11.4 10.1–14.4 10.0–11.0 13.5–14.0 14.6–14.9 10.9–11.8 15.1–16.6
ED 4.3–5.0 5.4–6.4 4.7–5.0 5.5–6.0 5.7–5.8 4.4–4.7 5.5–5.6
TD 2.1–2.7 3.1–3.5 1.8–2.0 2.2–2.4 2.1 1.3–1.4 1.5–1.8
ESL 4.8–5.4 6.5–7.6 4.9–5.4 6.4–7.0 6.8–7.0 5.6–6.0 7.2–7.7
FLL 25.7–28.2 32.7–40.3 22.5–25.5 30.5–32.5 32.3–32.5 26.6–28.6 34.8–38.8
HLL 59.5–67.2 74.3–85.5 58.2–65.6 81.5–87.7 82.3–83.5 72.4–75.9 92.3–99.3
TL 17.7–20.3 22.3–25.6 17.4–20.4 24.8–27.0 27.2–27.8 21.6–22.7 27.0–29.1
FOT 25.7–29.4 31.2–36.0 25.0–28.6 34.8–37.2 37.4–38.0 30.5–32.2 39.2–42.6
HL/SVL 0.33–0.37 0.31–0.33 0.34–0.36 0.32–0.35 0.32–0.33 0.35–0.36 0.33–0.34
HW/SVL 0.28–0.33 0.26–0.31 0.30–0.33 0.29–0.32 0.31 0.30–0.32 0.32
ESL/SVL 0.14–0.17 0.15–0.17 0.15–0.16 0.15 0.14–0.15 0.15–0.16 0.14–0.16
ED/HL 0.36–0.44 0.36–0.44 0.41–0.44 0.36–0.39 0.36–0.38 0.34–0.36 0.33–0.34
TD/HL 0.19–0.23 0.20–0.27 0.17 0.14–0.16 0.13–0.14 0.10–0.11 0.09–0.11
FLL/SVL 0.77–0.87 0.71–0.85 0.70–0.75 0.68–0.72 0.67–0.68 0.72–0.77 0.73–0.76
HLL/SVL 1.79–2.00 1.70–1.93 1.87–1.94 1.81–1.92 1.71–1.76 1.98–2.09 1.85–2.00
TL/SVL 0.54–0.60 0.51–0.58 0.56–0.60 0.54–0.59 0.57–0.58 0.59–0.63 0.54–0.59
FOT/SVL 0.77–0.86 0.72–0.81 0.78–0.84 0.76–0.82 0.78–0.80 0.83–0.88 0.79–0.86

Uncorrected pairwise genetic distances (%) estimated from 16S rRNA sequences.

1 2 3 4 5 6 7 8 9 10 11 12
1 Types of Amolops ottorum
2 Topotypes of Amolops minutus 0.7
3 Amolops minutus from China 0.6 0.6
4 Amolops ailao 1.2 1.8 1.6
5 Amolops dafangensis 2.1 1.9 1.8 1.7
6 Amolops granulosus 2.2 2.8 2.5 2.7 1.8
7 Amolops jinjiangensis 1.6 1.6 1.4 2.1 1.1 2.1
8 Amolops lifanensis 5.8 8.0 8.4 8.3 4.8 7.6 7.3
9 Amolops loloensis 2.0 2.1 1.8 2.3 1.5 1.9 1.1 7.6
10 Amolops mantzorum 2.0 2.2 1.7 1.9 2.2 2.5 1.9 8.5 2.0
11 Amolops sangzhiensis 1.4 1.9 1.6 1.8 0.8 2.0 0.8 7.8 1.4 1.7
12 Amolops shuichengicus 1.6 2.8 2.7 2.9 1.7 2.7 1.9 7.9 2.4 3.0 1.8
13 Amolops tuberodepressus 1.8 2.7 2.2 2.5 2.1 2.1 1.7 8.2 1.8 1.8 1.8 2.8