Corresponding authors: Ye-Jie Lin (
Academic editor: Alireza Zamani
The theraphosid spider genus
A new species,
The spider family
The most distinctive feature of this genus is the basal, ventrally standing knife-like strikers on the chelicerae and a single or double row of paddle hairs (lyra) overlapped by a fringe of lesser stridulating setae on the maxillae (
Here, we describe a new species:
All specimens were preserved in 75% ethanol and the type specimens of
All measurements are in millimetres and were obtained with an Olympus SZX16 stereomicroscope with a Zongyuan CCD industrial camera. Body length was measured without chelicerae. Eye sizes were measured as the maximum diameter from either the dorsal or frontal view. The largest stridulatory seta was selected as the sample. The length of the contraction area is defined as the length from the position on the stalks that is as wide as the spermathecal lobe to the neck. The length of the spermathecal lobe is defined as the length from the neck to the terminal of the spermathecal lobe. The length of stalks is defined as the length from the neck to the end of the receptacles. Leg measurements are given as follows: total length (femur, patella, tibia, metatarsus, tarsus). The terminology used in the text and figures follows
A total of 366 bases of cytochrome oxidase I were sequenced by using the following primers: ExtA (5’-GAAGTTTATATTTTAATTTTACCTGG-3’) and ExtB (5’-CCTATTGAWARAACATARTGAAAATG-3’). This PCR profile consisted of an initial denaturing step at 94°C for 2 min, 30 amplification cycles [94°C for 30 s, 50°C or optimal annealing temperature (Tm°C) for 45 s, 72°C for 45 s], followed by a final extension step at 72°C for 5 min.
Materials from the following institutions were examined or had images of type material supplied to the authors:
Abbreviations:
Colouration in alcohol: Carapace, palp and legs red brown. Chelicerae and abdomen black (Fig.
Carapace 11.27 long, 9.82 wide, with long white setae. Eye group 2.02 long, 0.91 wide. MOA 1.24 long, anterior width 0.96, posterior width 1.24 (Fig.
Chelicera 6.94 long, 4.80 high, with long white grey setae. Promargin with dense brown hairs, retromargin with one row of 11 teeth, fang furrow with 35 denticles, strikers spiniform. Fang 5.54 long (Fig.
Labium 1.68 long, 2.21 wide, with 457 cuspules, covering almost 1/3 of area of labium, terminal brown, with long bristles (Fig.
Maxilla 4.73 long, 2.18 wide, with 267 cuspules. Stridulating lyra almost two times longer than height, with two kinds of stridulating setae: one row of 10 club-shaped, straight setae and dense spiniform setae (Fig.
Sternum 5.20 long, 4.47 wide, yellow brown, covered with two kinds of hairs: black erect bristles and non-erect brown hairs, separated from labium by fan-shaped areas. Three pairs of sigilla present, anterior pair small, oval; posterior pairs larger (Fig.
Legs with dense long and white setae on patellae and tibiae, without any spines. Tarsi I–III with 2 claws, tarsus IV with 3 claws, without denticle. Leg measurements: I 43.11 (12.46 + 4.92+ 11.17 + 8.57 + 5.99), II 37.47 (10.34 + 3.47 + 9.99 + 7.74 + 5.93), III 31.93 (8.07 + 3.28 + 8.09 + 8.12 + 4.37), IV 44.09 (11.57 + 3.45 + 11.55 + 11.92 + 5.60). Leg formula: 4123. Scopula on tarsus IV cracked by a band of macrosetae, scopulae of tarsi I–III not divided.
Abdomen 12.11 long, 6.37 wide, oval, without any pattern, covered with long light brown and white setae of varying lengths. PMS 1.75 long, PLS 8.99 long.
Palp (Fig.
Colouration in alcohol: Same as in male (Fig.
Carapace 18.75 long, 16.54 wide, with long light brown setae. Eye group 6.41 long, 2.72 wide. MOA 2.19 long, anterior width 2.87, posterior width 4.45 (Fig.
Chelicera 10.68 long, 7.93 high, with long light brown setae. Promargin with dense brown hairs, retromargin with one row of 18 teeth, fang furrow with 94 denticles, strikers spiniform. Fang 8.68 long (Fig.
Labium 2.60 long, 2.98 wide, with 580 cuspules, others as in male (Fig.
Maxilla 8.02 long, 4.29 wide, with 580 cuspules. Stridulating lyra almost three times longer than its height, others as in male (Fig.
Sternum 8.48 long, 5.13 wide, others as in male (Fig.
Legs with long and short brown setae, others as in male. Leg measurements: I 52.92 (15.19 + 6.58+ 13.56 + 9.37 + 8.22), II 45.25 (13.09 + 5.90 + 11.21 + 8.67 + 6.38), III 40.12 (10.16 + 5.30 + 9.04 + 9.04 + 6.58), IV 51.89 (13.47 + 5.46 + 12.72 + 13.18 + 7.06). Leg formula: 1423.
Abdomen 20.36 long, 12.38 wide, covered with long light brown setae of varying lengths. PMS 2.75 long, PLS 11.87 long.
Spermathecae (Fig.
The new species is similar in habitus to
However, the male of
The species is named after Mr. Shuo Qi, who collected type material; noun (name) in genitive case.
Known only from the type locality (China, Guangdong) (Fig.
The specimens were found in barren limestone rock walls with some vegetation (Fig.
CTATTATTAGATCATCTGTTGGGAAGCGTGAGCCCTTCGGAACTTTGGGAATAATTTATGCTATGGTTAGAATTGGTGGGATGGGGTTTGTTGTATGAGCTCATCATATGTTTTCTGTGGGAATAGATGTAGATACGCGGGCATATTTTACGGCAGCAACTATGGTGATTGCTGTCCCTACGGGAATTAGGGTATTTAGATGAATAGCTACGTTGTATGGATCTTACTTTAAGATGGATACCTCTTTGATATGGTGTGTTGGGTTCGTTTTTTTGTTTACTTTAGGGGGATTAACCGGGGTGGTTTTGGCTAATTCTTCTTTGGATATTATTTTGCATGATACTTATTATGTGGTTGCTCATTTTC (Ar43552, GenBank accession number
The manuscript benefited greatly from comments by Alireza Zamani, Rick C. West and Volker von Wirth. Danni Sherwood (UK) checked the English. Shuo Qi (Guangdong, Sun Yat-Sen University), Hanming Song (Guangdong, Sun Yat-Sen University), Yongyou Zhao (Guangdong, Shimentai National Nature Reserve), Fengbin Yu (Guangxi) and Jincheng Liu (Beijing) helped with the fieldwork. This research was supported by the National Natural Science Foundation of China (NSFC-31972869).
Tip of embolus of
Spermathecae of
Distribution records of