Biodiversity Data Journal :
Taxonomy & Inventories
|
Corresponding author: Hao Yu (insect1986@126.com)
Academic editor: Emma McCarroll Shaw
Received: 17 Jun 2023 | Accepted: 30 Jul 2023 | Published: 08 Aug 2023
© 2023 Weicheng Yang, Yufeng Zhou, Dongxue Gu, Hao Yu
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yang W, Zhou Y, Gu D, Yu H (2023) Pancorius guiyang sp. nov., a new species of jumping spiders (Araneae, Salticidae) from Guizhou Province, China. Biodiversity Data Journal 11: e108159. https://doi.org/10.3897/BDJ.11.e108159
|
Pancorius Simon, 1902 is a relatively large genus of jumping spider family Salticidae and currently contains 42 valid species that are mainly distributed in South East Asia, 11 of which are recorded from China.
A new spider species of the genus Pancorius from Guiyang City in southwest China, is described under the name of P. guiyang Yang, Gu & Yu, sp. nov. Detailed descriptions and photographs are provided. DNA barcodes (a partial fragment of the mitochondrial cytochrome oxidase subunit I gene, COI) of the species were obtained to confirm matching of the sexes and for future use in molecular studies.
new species, morphology, DNA barcoding, diagnosis, taxonomy
Pancorius Simon, 1902 is a relatively large spider genus of family Salticidae Blackwall, 1841, with a restricted distribution: distributed exclusively in South East Asia, except only one record known from Poland (
The genus Pancorius remains inadequately studied because: more than half of the species (26) are known from a single sex (15 from males, 11 from females) (
While examining spiders collected from Guiyang City, Guizhou Province, south-western China (Fig.
Male left palp of the holotype of Pancorius guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: Cy = cymbium; E = embolus; EB = embolar base; L= lobe; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum. Scale bar: 0.2 mm (equal for A–D).
Pancorius guiyang sp. nov., female paratype and male holotype, epigyne (A–E), frontal views of prosoma (F, G). A–B Macerated epigyne, ventral and dorsal; C–D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal (dashed line in D showing schematic course of copulatory duct and connecting duct, dorsal); E Intact epigyne, ventral; F Male; G Female. Abbreviations: AS = anterior chamber of spermatheca; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; P = epigynal pocket; PS = posterior chamber of spermatheca; SP = spermatheca. Scale bars: 0.2 mm (equal for A–E); 1 mm (F, G).
Specimens in this study were collected by hand collecting from leaf-litter in Xiangzhigou scenic spot, Guiyang, Guizhou. Spiders were fixed and preserved in 95% ethanol. Specimens were examined with an Olympus SZX7 stereomicroscope; details were studied with an Olympus CX41 compound microscope. Female epigyne and male palp were examined and illustrated after being dissected. Epigyne was removed and cleared in warm lactic acid before illustration. Vulva was also imaged after being embedded in Arabic gum. Photos were made with a Cannon EOS70D digital camera mounted on an Olympus CX41 compound microscope. The digital images were taken and assembled using Helifocus 6.80 software package.
A DNA barcode was also obtained for the species matching. A partial fragment of the mitochondrial cytochrome oxidase subunit I (CO1) gene was amplified and sequenced for two specimens, using the primers LCOI1490 (5’-GGTCAACAAATCATAAAGATATTG-3’) and HCOI2198 (5’-TAAACTTCAGGGTGACCAAAAAAT-3’). For additional information on extraction, amplification and sequencing procedures, see
All measurements were obtained using an Olympus SZX7 stereomicroscope and given in millimetres. Eye diameters are taken at widest point. The total body length does not include chelicerae or spinnerets length. Leg lengths are given as total length (femur, patella, tibia + metatarsus, tarsus). Most of the terminologies used in text and figure legends follow
The type specimens are deposited in the Museum of Guizhou Normal University, Guiyang, China.
Description. Male (holotype) (Fig.
Living holotype male as in Fig.
Habitus in ethanol (Fig.
Palp (Fig.
Female (Fig.
One living paratype female as in Fig.
Colour in ethanol Fig.
Epigyne (Fig.
5'GGTGCTTGAGCTGCTATAGTAGGAACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAACAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (holotype, YHGY199; Genebank: OR372102)
5'GGTGCTTGAGCTGCTATAGTAGGACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAGCAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (paratype, YHGY200; Genebank: OR372101)
The male of this new species closely resembles that of P. crinitus Logunov & Jäger, 2015 from Vietnam and P. candidus Wang & Wang, 2020 from China. The three species share the similarly distinctly short RTA whose apex points dorsally (vs. RTA relatively longer and apex pointing anteriorly in all other congeners). However, P. guiyang sp. nov. can be differentiated from P. crinitus and P. candidus by the distinctly slender, needle-shaped embolus without subdistal projection (Fig.
The species name is derived from the name of the type locality; noun in apposition.
Known from the Guiyang City, Guizhou Province, China (Fig.
Pancorius guiyang sp. nov. is a typical leaf-dwelling spider, the types inhabit bamboo forest close to a small stream in the core zone of Xiangzhigou scenic spot and were collected by beating twigs and branches.
We thank Cheng Wang (Tongren, China) and a anonymous referee for providing constructive comments on an earlier version of the manuscript. We are especially grateful to Emma McCarroll Shaw (Chiang Mai, Thailand), the subject editor of this manuscript. We are also grateful to Qianle Lu (Shenzhen, China) for his kind help in collecting the specimens and for agreeing to use his pictures of live specimens. This work was supported by the National Natural Sciences Foundation of China (NSFC-32060113/3202006), the Natural Science Foundation of Guizhou Province (J[2020] 1Y081), the Project of Biodiversity Survey and Assessment in Guiyang(GZZC-2021-018), the Guizhou Science and Technology Support Program ([2017]2811) and the Forestry Science and Technology Research Program of Guizhou Forestry Department ([2022]27).