|
Biodiversity Data Journal :
Taxonomy & Inventories
|
|
Corresponding author: Yejie Lin (linyejie15@gmail.com)
Academic editor: Yanfeng Tong
Received: 26 Sep 2023 | Accepted: 03 Nov 2023 | Published: 10 Nov 2023
© 2023 Yejie Lin, Shuqiang Li
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lin Y, Li S (2023) A new species of Liphistius Schiødte, 1849 (Araneae, Liphistiidae) from Yunnan, China. Biodiversity Data Journal 11: e113290. https://doi.org/10.3897/BDJ.11.e113290
|
|
The spider genus Liphistius Schiødte, 1849 contains 69 species, endemic to Indochina and Southeast Asia. Only one species is currently known from the Chinese province of Yunnan: Liphistius nabang Yu, Zhang & Zhang, 2021.
A new species, Liphistius liz Lin & Li, sp. nov., is described from Yunnan, China, on the basis of both sexes. Photos and a morphological description of the new species are provided.
diagnosis, Asia, spider, type
Heptathelidae Kishida, 1923 and Liphistiidae Thorell, 1869 are the extant families of the suborder Mesothelae Pocock, 1892 in the Araneae Clerck, 1757 and the most basal lineage of all existing spiders (
Chinese spider taxonomists have published a large number of papers in the 21st century, but due to the rich biodiversity of the Chinese territory, there are still many unknown species (
All specimens were preserved in 80% ethanol. The spermathecae were cleared in trypsin enzyme solution to dissolve non-chitinous tissues. Specimens were examined under a Leica M205C stereomicroscope. Photographs were taken with an Olympus C7070 zoom digital camera (7.1 megapixels). Photographs were stacked with Helicon Focus (v. 7.6.1) or Zerene Stacker (v. 1.04) and processed in Adobe Photoshop CC2022.
All measurements are in millimetres (mm) and were obtained with an Olympus SZX16 stereomicroscope with a Zongyuan CCD industrial camera. All measurements of body lengths do not include the chelicerae. Eye sizes are measured as the maximum diameter from either the dorsal or the frontal view. Legs were measured laterally. Leg measurements are given as follows: total length (femur, patella+tibia, metatarsus, tarsus). The terminology used in the text and figures follows
A total of 1533 bases of cytochrome oxidase I were sequenced by using the following primers: ExtA (5’-GAAGTTTATATTTTAATTTTACCTGG-3’) and ExtB (5’-CCTATTGA WARAACATARTGAAAATG-3’). This PCR profile consisted of an initial denaturing step at 94°C for 2 min, 30 amplification cycles [94°C for 30 s, 50°C or optimal annealing temperature (Tm°C) for 45 s, 72°C for 45 s], followed by a final extension step at 72°C for 5 min.
Types from the current study are deposited in the Institute of Zoology, Chinese Academy of Sciences in Beijing (IZCAS).
Abbreviations used in text: ALE, anterior lateral eye; AME, anterior median eye; PLE, posterior lateral eye; PME, posterior median eye.
Male (holotype, Figs
Vulva of Liphistius liz sp. nov., paratype female. A dorsal view; B ventral view. Abbreviations: ALP, anterolateral protuberance on poreplate; BM, bulging margin on ventral poreplate; CDO, central dorsal opening; DOP, dorsal opening of posterolateral protuberance on poreplate; GA, genital atrium; PLP, posterolateral protuberance on poreplate; PPl, poreplate; PS, posterior stalk; RC, receptacular cluster.
Palp (Figs
Female (paratype, Figs
Vulva (Fig.
Males of the new species resemble Liphistius nabang Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig.
The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see
CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).
Liphistius nabang: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.
Vulvae of two paratype females, see Fig.
The manuscript benefitted greatly from comments by Yanfeng Tong (Shenyang, China), Hirotsugu Ono (Tokyo, Japan) and Kun Yu (Baoding, China). Yicheng Lin (Tengchong, China) helped with fieldwork. Danni Sherwood (UK) checked the English.