Samples were collected from intertidal rocks covered with algae on Dalei Island (27°29.82'N, 121°06.17'E), Zhejiang, China, in July 2020. All specimens were preserved in 95% ethanol and stored at the Laboratory of Shellfish Genetics and Breeding (LSGB), Fisheries College, Ocean University of China, Qingdao, China. Before being selected for further analysis, the specimens were cleaned using ultrasound at 40 kHz for 30 s.

Standard views (top view, lateral view and bottom view) of the shells were captured using a DS-Fi2 digital camera (Nikon) mounted on a stereomicroscope. For scanning electron microscopy (SEM), radulae were collected during DNA extraction following the method outlined by Qi et al. (2020). The radulae were cleaned using 10% sodium hydroxide (NaOH) for 0.5 h and then rinsed with double-distilled water (ddH₂O). The shells, radulae and opercula were mounted on stubs, thinly coated with gold and examined using a FlexSem 1000 II SEM.

Total genomic DNA was extracted from whole animals using the TIANamp Marine Animals DNA Kit (Tiangen Biotech, Beijing, China) following the manufacturer’s protocol and stored at 4°C for short-term use. The mitochondrial marker cytochrome oxidase subunit I (COI) was then amplified with the primers LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994). Each PCR sample (10 μl) contained 4 μl of DNA extract and 6 μl of PCR mix (0.2 μl ddH₂O, 5 μl of 2× Taq Plus Master Mix II (Dye Plus; Vazyme, Nanjing, China), 0.4 μl of 10 μM forward primer and 0.4 μl of 10 μM reverse primer). The PCR conditions were as follows: a predenaturation at 94°C for 3 min; 35 cycles of denaturing at 94°C for 45 s, annealing at 48°C for 45 s and extension at 72°C for 60 s; and a final extension step at 72°C for 10 min. PCR products were confirmed by 1.5% agarose gel electrophoresis, stained with ethidium bromide, purified using the EZ Spin Column PCR Product Purification Kit (Sangon) and sequenced in both directions using an ABI 3730 automatic sequencer (Applied Biosystems) at the LiuHe HuaDa Biotechnology Company (Beijing, China). The sequences were assembled and manually curated using SeqMan (www.DNASTAR.com). Relevant COI sequences of the trochids were retrieved from GenBank (Suppl. material 1). Pairwise genetic distances (p‐distance) between datasets (Minolia, Conotalopia and Solariella) were calculated using MEGA 5 (Tamura et al. 2011).

The genetic distance between C. sematensis and the analysed species ranged from 16.1% to 22.6% (Table 1), indicating a close relationship with other Conotalopia species.

Conotopala differs from other trochids by turbinate, spirally ribbed, carinate, umbilicus wide and funnel-shaped, columella arched, simple and meeting the parietal wall at a steep angle, these characteristics also being observed in our samples. Our sample aligned with the description of Conotalopia provided by Barry (1993). Morphologically, our samples closely resembled Conotalopia sematensis (Oyama, 1942) (Fig. 1M), as documented by Yokoyama (1922), Yokoyama (1926), Taki and Oyama (1954) and Oyama (1973). The key diagnostic features that distinguish C. sematensis from other Conotalopia species include the presence of dense axial growth lines on the surface and one or two faint threads between the two angles. Although our specimens had a lower spire compared to the specimen described by Yokoyama (1922), the characteristics of the shell surface of our specimens are consistent with Conotalopia sematensis (Fig. 1M). The shell is sharply angulate a little above the middle, with a slightly sloping surface above the angle and a very steep surface below. There are one or two fainter threads on the surface of the whorls and oblique lines of growth can be seen everywhere. The periphery of the umbilicus is ornamented with spiral striae and crossed by lines of growth. These characteristics were observed in both our samples and Conotalopia sematensis (Fig. 1M). Therefore, we consider our specimens to be subadult.

Moreover, our small shells exhibited some similarities to Conotalopia ornata (G. B. Sowerby III, 1903), but detailed differences were evident. Notably, there was an absence of cancellated sculptures created by spiral ribs and growth lines on the surface of the whorls and the zone above the shoulders was slightly sloped rather than flat. In terms of the radula, the central tooth of C. sematensis is spade-shaped and the lateral teeth have cusps. In contrast, the central teeth of C. ornata have a somewhat protruding frontal margin, whereas the lateral teeth lack cusps (Habe 1958). Molecular studies support this distinction, with a genetic distance of 16.7% between our sample and C. ornata (Table 1). In summary, this species can be clearly distinguished from other Conotalopia species (Suppl. material 2).