Fieldwork conducted in May 2023 at the Guanyinshan Provincial Nature Reserve, Yuanyang, Yunnan, China, resulted in the mist-net capture of a bat specimen (field collection number KIZ20230423) in Pinghe, Xiaoxin Street Township (103.00°E, 22.99°N, altitude 2434 m). The specimen was deposited at the Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS).

Detailed morphological descriptions were performed on the collected specimen. Ten external measurements were extracted from field records, including: weight (WT), head-body length (HB), tail length (TAIL), ear length (EAR), hind-foot length (HF), forearm length (FA), tibia length (TIBIA), total length of third digit (DIG3), total length of fourth digit (DIG4) and total length of fifth digit (DIG5). Based on the character descriptions in Görföl et al. (2020), cranial and dental measurements were taken with a digital caliper to the nearest 0.01 mm and included: greatest length of skull (GTL): from anterior aspect of first upper incisor to the most prominent point of occipital region; total length of skull (STOTL): from anterior rim of alveolus of first upper incisor to the most projecting point of occipital region; condylobasal length (CBL): from exoccipital condyle to posterior rim of alveolus of first upper incisor; condylocanine length (CCL): from exoccipital condyle to the most anterior part of canine; zygomatic width (ZYW); braincase width (BCW); braincase height (BCH); interorbital width (IOW); mastoid width (MAW); maxillary toothrow length (UCM3L); upper canine-premolar length (UCP4L); upper canine width (UCCW); upper molar greatest width (UM3M3W); upper molar length (UM1M3L); mandible length (MANL); mandibular tooth-row length (LCM3L); lower canine-premolar length (LCP4L); coronoid height (CPH); and lower molar length (LM1M3L).

Genomic DNA was extracted from muscle tissue preserved in anhydrous ethanol using the Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech, China) in accordance with the manufacturer’s instructions. The complete sequence was amplified and sequenced by utilising primer pairs LGL765: GAAAAACCAYCGTTGTWATTCAACT and LGL766: GTTTAATAAGAATYTYA GCTTTGGG (Bickham et al. 1995) for the cytochrome b (Cyt b) gene; COF: TTCTCAACCAA CCACAAAGACATTGG and COR: TAGACTTCTGGGTGGCCAAAGAATCA (self-designed and optimised) for the cytochrome oxidase subunit I (COI) gene; and 179F: CAGTTTTCTCTAAGGAYTC CTGC and 1458R: TTGCTATCTTCACATGCTCATTGC for the recombination activating gene 2 (RAG2) gene (Stadelmann et al. 2007). Polymerase chain reaction (PCR) was conducted in a 25-μl system comprising 1 μl of template DNA, 1 μl of each primer (10 μM), 1 μl of 10 μM dNTP (mix), 2.5 μl of 10× Taq Buffer (with MgCl₂), 0.2 μl of 5 U/μl Taq polymerase (Sangon Biotech, China), supplemented with ddH₂O to a final volume of 25 μl. The PCR protocols entailed an initial denaturation at 95℃ for 5 min, succeeded by 10 cycles of denaturation at 94℃ for 30 s, annealing at 63℃ (with a decrement of 0.5°C per cycle) for 30 s and extension at 72℃ for 30 s, followed by 30 additional cycles of denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, final extension at 72℃ for 10 min and renaturation at 4℃.

The PCR products were visualised by agarose gel electrophoresis and purified using a SanPrep Column DNA Gel Extraction Kit (Sangon Biotech, China). Finally, the purified samples were sequenced using an ABI 3730XL instrument (USA) at Sangon Biotech (Shanghai, China). The obtained sequences were edited and assembled using SeqMan in DNASTAR v.7.1 (DNASTAR Inc., Madison, WI, USA).

A comparative analysis was performed on the Cyt b, COI and RAG2 sequences from our specimen against 12 sequences for each gene from the National Center for Biotechnology Information (NCBI) database. These sequences were identified using GenBank accession numbers provided in Görföl et al. (2020) (Table 1). Alignment was conducted using the ClustalW algorithm (Thompson et al. 1994) with default parameters in MEGA11 (Tamura et al. 2021). Sequences exceeding specific lengths were truncated as follows: COI to 657 bp; Cyt b to 1 140 bp; and RAG2 to 1 151 bp. Genetic distances were calculated using the pairwise distance parameter within the distance module. Uncorrected P-distances were obtained by a bootstrap procedure with 1000 replicates. Phylogenetic reconstructions for Cyt b, COI and RAG2 were carried out using Bayesian Inference (BI) with MrBayes v.3.2.6 (Ronquist et al. 2012) executed in PhyloSuite v.1.2.2 (Zhang et al. 2020), employing a partition model with two parallel runs and 2,000,000 generations. The initial 25% of sampled data were discarded as burn-in. ModelFinder (Kalyaanamoorthy et al. 2017) was used to select the best-fit model, based on the Bayesian Information Criterion (BIC): Cyt b, GTR+F+I+G4; COI, HKY+F+I; and RAG2, K2P+G4. Uncorrected P-distance and evolutionary analyses were conducted using MEGA11. Data retrieval and organisation were performed using PhyloSuite v.1.2.2 (Zhang et al. 2020) and evolutionary trees were edited with iTOL v.6 (Letunic and Bork 2021).

Body

Moderate size, with head-body length of 54.73 mm, tail length of 42.56 mm and forearm length of 37.31 mm (Table 2). Mouth and nose round, thick and swollen in appearance, forming prominent cheek pouches. Several long whiskers present on sides of nose. Ears fleshy, large and circular in shape; auricle short, wide, extending below snout; earlobe incompletely developed, exceptionally small, extending upwards; inner margin recessed, outer margin pronounced and elevated (Fig. 1). Wings long and narrow, displaying common characteristics of bats capable of fast flight (Fig. 1). Third finger (64.10 mm) 22.89 mm longer than fifth finger (41.21 mm), consistent with description by Görföl et al. (2020) (Table 2). Tail and wing membranes with uniform black hue; tip of tail bone protruding approximately 2 mm beyond tail membrane; wing membrane attached to ankle bone (Fig. 1). Specimen male, external morphology evident, penis bone absent upon dissection.

Figure 1.  

Photo of Mirostrellus joffrei specimen (collection number KIZ20230423) from this study.

Fur

Fur soft and lustrous in appearance, moderate length. Overall colour of dorsal fur blackish-brown and glossy, ventral fur golden-brown with clear demarcation when viewed from side. Hair at tip of snout short and sparse. Middle of lower jaw greyish-white, sides golden-brown, upper jaw blackish-brown with brown spots. Hair almost non-existent on forearms, tibia and feet (Fig. 1).

Skull

Skull moderate in size, compact in appearance, with short and wide snout (Fig. 2A and B). When viewed from the side, there is a gradual upward slope from front of nose to back of forehead, with slight indentation in centre of forehead and well-developed supraorbital tubercles, protruding noticeably beyond outline of skull. Sagittal crest low and slightly protruding from skull, but not prominent (Fig. 2D). Entire cranial cavity rectangular in shape, infraorbital foramen prominent. Middle part of zygomatic arch slightly protruding upwards (Fig. 2D). When viewed from above the aspect of the cranium, the cranial cavity appears slightly rounded, with slight inward concavity in the middle of the zygomatic arch (Fig. 2A and B). Mandible slightly robust, with relatively high coronoid process. Area between coronoid process and condyle relatively smooth, lacking distinct concavity. Line connecting condyle and angle of mandible perpendicular to mandibular body. Angle of mandible straight, without curvature, forming approximate 30-degree angle with elongation line of mandibular body (Fig. 2E).

Figure 2.  

Cranial morphology of Mirostrellus joffrei (KIZ20230423 and HNHM 26041 from Mu Cang Chai, Vietnam). A Dorsal view of skull; B Ventral view of skull; C Dorsal view of mandible; D Left-side view of cranium; E Lateral view of the left mandible; F Lateral view of skull of Mirostrellus joffrei from Mu Cang Chai, Vietnam (HNHM 26041) (Görföl et al. 2020); G Medial view of left maxillary dental arch; H Maxillary incisors and canines; I Medial view of right maxillary dental arch; J Mandibular incisors and canines.

Dentition

Dental formula I 2/3, C 1/1, P 2/2 and M 3/3 (Fig. 2B, C, H and I). Upper incisors wide and short, exhibiting distinct bicuspid shape, noticeably taller than outer incisors (Fig. 2H). Upper canines larger, with distinct cusp located in middle of posterior edge (Fig. 2D). First upper premolar (P²) tiny, located between upper canine and second upper premolar (P³) in right dental arcade (Fig. 2I), not visible to the naked eye in left dental arcade (Fig. 2G). P³ well-developed, approximately half the size of the canine (Fig. 2D). Lower incisors aligned in a row (Fig. 2J), lower canines slender, lacking cusp (Fig. 2E). Height of first lower premolar (P₂) slightly lower than that of second lower premolar (P₄) (Fig. 2E), lower molars clearly myotodont (Fig. 2B). These characteristics are consistent with descriptions by Thomas (1915), Saikia et al. (2017) and Görföl et al. (2020) for this species.

The NCBI database alignment for the Cyt b, COI and RAG2 sequences classified the specimen as M. joffrei, with sequence identities of 99.47%, 99.85% and 99.57%, respectively. The uncorrected P-distances between our specimen and M. joffrei for the Cyt b, COI and RAG2 genes were notably small, significantly lower than those observed for other species, as outlined in Tables 3, 4. In phylogenetic analysis, our specimen clustered with M. joffrei, forming a monophyletic group supported by a posterior probability of 1 (Fig. 3A, B and C).

Figure 3.  

Phylogenetic tree depicting relationships amongst selected vespertilionid bat species, constructed using Bayesian Inference. Glischropus bucephalus, Pipistrellus pipistrellus and Nyctalus leisleri were designated as the outgroup. Posterior probabilities are shown adjacent to nodes (nodes with posterior probabilities < 0.50 are not labelled). Analysis based on sequences from: A Cyt b gene; B COI gene; C RAG2 gene.