Biodiversity Data Journal :
Taxonomy & Inventories
|
Corresponding author: Mar Ferrer-Suay (mar.ferrer@uv.es)
Academic editor: Jessica Awad
Received: 15 Feb 2024 | Accepted: 11 Apr 2024 | Published: 20 May 2024
© 2024 Jonathan Vogel, Ralph Peters, Jesús Selfa, Mar Ferrer-Suay
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Vogel J, Peters RS, Selfa J, Ferrer-Suay M (2024) Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data. Biodiversity Data Journal 12: e120950. https://doi.org/10.3897/BDJ.12.e120950
|
|
The taxonomy of the hymenopteran parasitoid subfamily Charipinae (Hymenoptera: Cynipoidea: Figitidae) has, until recently, been in a state of chaos. While this situation has improved significantly in recent years, most of the efforts were focused on morphological data of typically old specimens. Here, we present the first integrative approach to describe the diversity of the genus Phaenoglyphis Förster, 1869 from north-western Europe.
For seven (of a total of 17) species, we provide DNA barcode data. Phaenoglyphis belizini Pujade-Villar, 2018 and Phaenoglyphis evenhuisi Pujade-Villar & Paretas-Martínez, 2006 are recorded for the first time from Germany. All DNA barcodes and specimen data were added to the publicly available GBOL and BOLD reference database. The presence of a 6 bp long deletion in the CO1 barcode region that is characteristic to the genus and unique amongst Figitidae supports the monophyly of Phaenoglyphis.
Charipinae, Phaenoglyphis, integrative taxonomy, CO1 barcoding, GBOL III: Dark Taxa, new records
Cynipoidea includes phytophagous gall formers or parasitoids of other insects. There are seven recognised families within Cynipoidea: Austrocynipidae, Ibaliidae, Liopteridae, Cynipidae, Diplolepidae, Paraulacidae, and Figitidae (
This genus is the second-most diverse within Charipinae. Species are typically smooth, shiny and small with a body length of 0.8 to 2.0 mm, just like their fellow charipines. Phaenoglyphis, however, can be easily distinguished by the presence of a mesopleural line and a well-segmented metasoma. Most species possess clearly delineated scutellar foveae and some show slightly to heavily ingrained notauli. The genus currently includes 34 extant species and is found worldwide (
Re-descriptions and a key for all Palaearctic species of Phaenoglyphis were published in
Integrating results from analysis of molecular sequence data is routine in our modern taxonomic toolkit. Sequence data, most notably of the CO1 barcode region, become increasingly attractive in ecological studies and biomonitoring schemes as more and more species are added to publicly available reference libraries (https://data.bolgermany.de/ergebnisse/results (
Our main objective is to improve the delimitation and characterisation of species within Phaenoglyphis in an integrative taxonomy approach. Additionally, we provide new country records as well as a newly-found character pointing towards monophyly of the genus.
Institutional abbreviations
All specimens with the ‘ZFMK-TIS-...’ tag were prepared at the molecular laboratory of the ZFMK in Bonn in the course of the GBOL III: Dark Taxa project, following the procedures as described in
Using IQ-Tree v.2.2.2.6, we reconstructed a Maximum Likelihood tree by applying the -s option and ultrafast bootstrap with 1000 replicates (
For the molecular characterisation of species, we used the distance matrix from the alignment provided in Geneious (Suppl. material
All specimens were left externally intact during DNA extraction and each was point-mounted post lysis using Shellac glue. We attempted to spread the legs and wings so that no other body part was obscured. The metasoma was aligned with the body axis. All specimens are deposited at ZFMK unless stated otherwise.
All specimens were examined using a Leica M205C stereomicroscope (JV & RSP) and Optika ZSM-2 (MFS). Morphological terms and abbreviations are taken from
Like in Alloxysta, the metasomal tergites are not fused in Phaenoglyphis. It is the only genus which has a mesopleural sulcus, which differentiates it from Alloxysta and other charipine genera. The presence of notauli and the presence and shape of the scutellar foveae are also unique for many Phaenoglyphis species within the charipines (though both notauli and scutellar foveae are absent in some Phaenoglyphis species).
A 6 bp deletion is characteristic for the genus Phaenoglyphis. It is unique within Figitidae and shared with Ibalia Latreille, 1802 (Fig.
Barcode alignment excerpt showing the 6 bp deletion that is present in all studied Phaenoglyphis specimens and species as well as in Ibalia (Ibaliidae) and some more distantly-related Hymenoptera taxa. The non-Charipinae sequences were accessed via BOLD and were chosen, based on previously reported gaps in the CO1 barcode region.
Maximum Likelihood tree, based on CO1 barcode data (produced with IQ Tree) with ultrafast bootstrap values shown on the branches. The clusters of the species delimitation algorithms are shown to the right, summarised as bars (ASAP 1st and 2nd, multirate PTP and Species Identifier with a threshold of 3%). The black bars indicate delimitation results that match our morphological identifications, while red bars represent conflicts between morphology and molecular species delimitation.
Female antennae with rhinaria beginning on F3, pedicel longer than F1, F1 slightly longer than F2, F2 shorter than F3 (Fig.
Maximum barcode-distance within species: 2.5% (3).
Minimum barcode-distance to closest species: 6.3% (P. villosa)
Consensus barcode sequence (652 bp):
5’-AATTTTATATTTTATTTTTGGAATTTGGTCAGGAATAATTGGATCTGCTTTAAGAATAATTATTCGTATAGAATTAGGAACTCCATCACAACTTATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAGTTGGAGGATTTGGAAATTATTTAGTTCCTTTAATATTATCAGCTCCAGATATAGCATTTCCTCGTCTTAATAATATAAGATATTGATTATTATTACCAGCTTTAATTTTATTAGTATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGGTGAACAGTCTATCCTCCTTTATCTTCAAATTTAAGACATTCAGGAATTTCTGTTGATTTAACAATTTTTGCTTTACATTTAAGAGGAGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTTTAAATATACGAGTAATTTCAATAGATAAAATTTCTTTATTTATTTGATCAATTTTTTTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGGTATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCAATAGGAGGAGGGGATCCAATTCTTTACCAACATTTATTT-3’
China: Beijing province (
Female antennae with rhinaria beginning on F4, pedicel shorter than F1, F1 longer than F2, F2 subequal to F3, F3 shorter than F4 (Fig.
Maximum barcode-distance within species: 0.3% (3).
Minimum barcode-distance to closest species: 8.9% (P. longicornis).
Consensus barcode sequence (652 bp):
5’-TTTATTATATTTTATTTTTGGAATTTGGTCAGGTATAATTGGATCCGCCCTAAGAATAATTATTCGTATAGAATTAGGGACCCCTTCTTCATTAATTGGAAATGATCAAATTTATAATTCAATTGTAACAGCCCACGCTTTTATCATAATTTTTTTTATAGTAATACCTATCATAGTCGGGGGATTTGGTAATTATTTAGTCCCATTAATATTAAGGGCCCCAGATATAGCTTTCCCACGTTTAAATAACATAAGTTTTTGATTATTGCCCCCTGCTTTATTTTTATTAGTTTCTAGAATATTTATTGATCAAGGGGCTGGAACTGGATGAACGGTTTATCCGCCCCTTTCATCTAATTTAGGACATTCAGGAATCTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGAGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCCTTAGATAAAATTTCCTTATTTATTTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCCGGAGGAATTACAATATTATTATTTGACCGAAATTTAAATACCTCTTTTTTTGACCCTATAGGAGGAGGTGATCCAATTTTATACCAACATTTATTT-3’
Andorra and France (
Antennae of both sexes with rhinaria beginning on F1, pedicel shorter than F1, F1 longer than F2, F2 subequal to F3, F3 shorter than F4 (Fig.
Maximum barcode-distance within species: not applicable (1).
(Minimum) barcode-distance to closest species: 4.9% (P. salicis).
Barcode sequence (652 bp):
5’-TTTATTGTATTTTATTTTTGGAATTTGATCGGGTATAATCGGGTCAGCTTTAAGAATAATTATCCGAATAGAATTAGGAACCCCATCTTCATTAATCGGTAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCAATTATAGTAGGGGGATTTGGAAATTATTTAGTTCCTCTAATATTAAGTGCTCCTGATATAGCTTTCCCACGATTAAATAACATAAGTTTTTGATTATTACCTCCTGCTTTATTTCTATTAATTTCTAGAATATTTATTGATCAAGGGGCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCATCTAATATAGGCCATTCAGGAATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGGGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATTTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGAATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGGGGAGACCCTATTTTATATCAACATTTATTT-3’
France, Germany, India, Romania, Spain, Sweden and United Kingdom: England, Scotland (
The species P. salicis and P. longicornis were inferred as conspecific only in the second-ranked partition in analyses with ASAP, but separate in all others, which is in line with our morphological concept of the two species.
Antennae of both sexes with rhinaria beginning on F3, pedicel shorter than F1, F1 longer than F2, F2 shorter than F3, F3 subequal to F4 (Fig.
Maximum barcode-distance within species: 0.2% (2).
(Minimum) barcode-distance to closest species: 4.9% (P. longicornis).
Consensus barcode sequence (652 bp):
5’-TTTATTGTATTTTATTTTTGGAATTTGATCAGGAATAATTGGATCAGCTTTAAGAATAATTATTCGAATAGAATTAGGCACCCCATCTTCATTAATTGGTAATGACCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGAGGATTCGGTAATTATTTAGTTCCTTTAATATTAAGGGCTCCTGATATAGCTTTCCCACGATTAAACAATATAAGTTTTTGATTATTACCCCCCGCTTTATTTTTATTAACTTCTAGAATATTTATTGATCAAGGAGCTGGAACTGGATGAACTGTTTAYCCACCTCTCTCCTCTAATTTAGGCCATTCAGGGATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATCTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGGATCACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGAGGAGACCCTATTTTATACCAACATTTATTT-3’
Austria, Germany, Ireland, Italy, Romania, Spain, USA: Colorado, and United Kingdom: England, Scotland, Wales (
See the taxon discussion of P. longicornis.
Antennae of both sexes with rhinaria beginning on the last two thirds of F1, pedicel shorter than F1, F1 longer than F2, F2-F4 subequal in length (Fig.
Maximum barcode-distance within species: 0.9% (2).
Minimum barcode-distance to closest species: 12% (P. xanthochroa).
Consensus barcode sequence (652 bp):
5’-GATATTATATTTTATTTTTGGTGTGTGATCTGGAATAATTGGGTCATCTTTAAGATTAATTATTCGAATAGAATTAGGAACACCAAACCAATTAATCGGAAATGATCAAATTTATAATTCTATTGTTACTGCYCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGGTTTGGTAATTATTTAATTCCTTTAATATTATCCGCCCCCGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGACTTTTACCTCCTGCTTTATTATTATTAACATCTAGAATATTTATTGATCAAGGGGCTGGAACAGGGTGAACAGTGTATCCTCCTTTATCATCTAATTTAGGTCATTCAGGYATTGCAGTTGATTTAACAATTTTTTCTTTACATATAAGAGGAATTTCATCAATTTTAGGGTCAATTAATTTTATTACAACAATCTTAAATATACGAATTGTTTCAYTAGATAAAATTTCTTTATTTATTTGATCCATTTTTTTAACAACAATTTTATTGTTATTATCTTTACCAGTATTAGCTGGAGGTATTACTATATTACTTTTTGATCGAAATTTAAATACYTCTTTTTTTGACCCTATAGGAGGAGGRGATCCTATTTTATAYCAACATTTATTT-3’
Andorra, Denmark, Finland, France, Germany, Mexico: Mexico City, Norway, Russia: Murmansk Oblast, Sweden, United Kingdom: England, and USA: Arizona, Iowa (
The specimens with their corresponding barcodes and identification were published prior to this study on BOLD. Though its occurrence in Norway has not been published in a scientific journal, we refrain from claiming to be the first to record the species for Norway, as this information was publicly available prior to this study.
Antennae of both sexes with rhinaria beginning on F3, pedicel as long as F1, F1 subequal to F2, F2 shorter than F3, F3 shorter than F4 (Fig.
Maximum barcode-distance within species: 2.6% (37).
Minimum barcode-distance to closest species: 6.3% (P. belizini).
Consensus barcode sequence (652 bp):
5’- AATTTTATATTTTATTTTTGGAATTTGGTCAGGAATAATTGGCTCTGCATTAAGAATAATTATTCGTATAGAATTAGGGACTCCTTCACAATTTATTGGGAATGATCAAATTTATAATTCAATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGAGGATTTGGTAATTATTTAGTCCCTTTAATATTATCAGCACCAGATATAGCGTTCCCTCGTCTTAATAATATAAGATACTGATTATTATTACCAGCATTAATTTTATTAGTTTCAAGAATATTTATTGATCAAGGGGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTTCTAATTTAAGACATTCAGGAATTTCAGTTGATTTAACAATTTTTGCTTTACATTTAAGGGGGGTTTCTTCAATTTTAGGGTCAATTAATTTTATTACTACAATTTTAAATATACGAATTATTTCAATAGATAAAATTTCTTTATTTATTTGGTCTATTTTCCTAACAACAATTTTATTATTATTATCTTTACCGGTTCTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGGGATCCAATTTTATACCAACATTTATTT -3’
Cosmopolitan (
P. villosa is reported to be morphologically considerably variable (
Phaenoglyphis xanthochroa is easily differentiated from the other Phaenoglyphis species by its dark yellow body and deeply excavated notauli (Fig.
Maximum barcode-distance within species: 2.3% (2).
Minimum barcode-distance to closest species: 10.7% (P. villosa).
Consensus barcode sequence (652 bp):
5’- GATTTTATATTTTATTTTTGGGATTTGGTCAGGAATAATTGGCTCAGCTTTAAGAATAATTATTCGAATAGAATTAGGAACCCCTTCTCAATTGATTGGTAATGATCAAATTTATAATTCAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGTGGGTTTGGGAATTATTTAATTCCTTTAATATTATCAGCCCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGGTTATTAATCCCAGCTTTATTTCTATTAATTATAAGAATATTTATTGATCAAGGGGCAGGGACTGGATGAACTGTTTACCCTCCTTTATCTTCAAATTTAGGTCATTCTGGGATTTCTGTTGATTTAACAATTTTTTCACTTCATTTAAGAGGAGTATCTTCAATTTTAGGGGCAATTAATTTTATTTCAACAATTTTAAATATACGAATTATTARAATAGATAAAATTTCATTATTTATTTGATCAATTTTTTTAACAACAATTTTATTATTATTGTCTTTACCTGTTTTAGCTGGAGGTATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT-3’
Austria, Czech Republic, Finland, France, Germany, Ireland, Poland, Sweden, Switzerland, The Netherlands, and United Kingdom: England (
The sequence with the BOLD-ID AMTPB279-15 has an associated photograph uploaded on BOLD. The specimen shown exhibits the unique morphology of P. xanthochroa and the identity is further confirmed by an expert hymenopterist. These circumstances led us to include the specimen into the molecular characterisation of the species. Phaenoglyphis xanthochroa is so unique in morphology and shows a large distance to the barcode sequences of other Phaenoglyphis species that it leaves room for debate whether to put this species in its own genus. We refrain from doing so as we think that a more thorough molecular dataset needs to back up this decision and the practical use of a monotypic genus is very limited.
Out of 55 specimens processed, 48 barcode sequences were generated (87% success rate). Including the publicly available barcodes from BOLD, the final dataset consists of 101 ingroup and three outgroup sequences.
The species limits established by morphological features are corroborated by the molecular results (Fig.
We complement the previously-established morphological characterisation of the genus Phaenoglyphis and seven of its species from north-western Europe (Ferrer-Suay et al. 2018) with the first molecular characterisation of their respective DNA barcode sequences: P. belizini, P. evenhuisi, P. longicornis, P. salicis, P. stricta, P. villosa, and P. xanthochroa. This currently leaves ten species known from north-western Europe without molecular characterisation (P. abbreviata, P. americana, P. calverti, P. fuscicornis, P. gutierrezi, P. heterocera, P. nigripes, P. proximus, P. pubicollis and P. ruficornis).
We complement BOLD with additional sequences for all of the molecularly characterised taxa, except P. stricta, for which we did not provide any additional sequences. Four of the taxa within our material were not represented on BOLD before (P. belizini, P. evenhuisi, P. longicornis, and P. salicis).
Our discovery of P. belizini and P. evenhuisi in our material represents new records for Germany.
The results of the mPTP and SpID species delimitations were largely congruent with our morphological identifications. There is an apparent over-splitting by the second-ranked ASAP partition and one case of lumping in the first-ranked ASAP partition. This could be interpreted as additional evidence that it is advisable to use more than one species delimitation algorithm and is in line with previous findings (e.g.
Ten species from north-western Europe are currently lacking CO1 barcode sequences and these can hopefully be added in future investigations. It is important to note that, within Charipinae, Alloxysta specimens are the most common and they are very well represented in many samples, but Phaenoglyphis is comparably rare, which makes it more difficult to acquire a good number of fresh specimens for sequencing.
The 6 bp deletion, present exclusively in the Phaenoglyphis barcodes within Charipinae, is additional evidence for the monophyly of the genus that was previously questioned (
Molecular characterisation of Charipinae species is still at its first steps. With this study, a significant portion of one of the main genera, Phaenoglyphis, is now ready to be included in DNA barcode-based activities. However, many species remain uncharacterised and it will be necessary to continue integrative taxonomy studies and to improve our knowledge of the genus.
M. Ferrer-Suay is supported by the project GE 2023 from the Council of Innovation, Universities, Science and Digital Society (reference: CIGE/2022/158).
J. Vogel and R.S. Peters are supported by a grant from the Federal Ministry of Education and Research (BMBF), Berlin, Germany (FKZ 16LI1901A), for the project ‘GBOL III: Dark Taxa’. The Federal Ministry of Education and Research of Germany (Bundesministerium für Bildung und Forschung, BMBF) is funding the project “GBOL III: Dark Taxa” as Research for Sustainable Development (Forschung für Nachhaltige Entwicklung, FONA; www.fona.de) under the funding reference 16LI1901A-E.
We thank Brill for allowing us to reuse parts of the figures published in Ferrer-Suay et al. (2019) to compose the figure plates presented herein.
We want to thank all local and regional authorities for granting us permission to collect the specimens. We would like to thank the DINA project team and the GBOL III: Dark Taxa consortium for providing valuable samples in general and the GBOL team, including Saskia Bartsch and the Kellerwald-Edersee National Park, especially Carsten Morkel, for the specimens from the recent samples from Kellerwald-Edersee.
We thank Fons Verheyde, Augustijn de Ketelaere, Wouter Dekoninck and all the diligent Belgian and Dutch collectors for granting us access to valuable material from the Low Countries.
We thank Ximo Mengual and Santiago Jaume Schinkel for forwarding the Icelandic samples and Christina Remschak for providing samples from Austria.
Björn Müller, Anja Bodenheim and Josefine Schwingeler deserve special credit for extra effort in collecting and processing the sample HM128-04-CC with HotShot extraction and Nanopore sequencing.
We thank Irene Lobato-Vila and Miles Zhang for their thorough reviews and constructive comments which helped us very much to improve the manuscript.
Last, we thank our beloved fellow hymenopterists Carolin Gilgenbach and Tobias Salden for collecting and providing samples from the ZFMK garden and Monsheim and Dra. Palmira Ros-Farré for taking the images presented here.
The table lists all specimens used for the molecular species delimitation methods, including the specimens studied morphologically, that were used to molecularly characterise the genus and each species.
The data matrix showing the CO1 barcode sequence distances between all individuals that were studied morphologically. This table is the basis for the molecular characterisation of the species.