Biodiversity Data Journal :
Data Paper (Biosciences)
|
Corresponding author: Yingchun Xing (xingych@cafs.ac.cn)
Academic editor: Yahui Zhao
Received: 08 May 2024 | Accepted: 06 Jun 2024 | Published: 14 Jun 2024
© 2024 Chongzhao Wang, Zhenhua Ma, Kun Cao, Xin Wang, Rui Xi, Ting Jiang, Rui Yang, Yingchun Xing
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Wang C, Ma Z, Cao K, Wang X, Xi R, Jiang T, Yang R, Xing Y (2024) Species diversity of fish at the Wuzhizhou Island, South China Sea, based on environmental DNA. Biodiversity Data Journal 12: e127120. https://doi.org/10.3897/BDJ.12.e127120
|
|
Wuzhizhou Island (WZZ) is located in Haitang Bay in the northern region of Sanya, Hainan Island. The sea area surrounding WZZ represents a typical tropical marine ecosystem, characterised by diverse and complex habitats. Therefore, there is a rich variety of marine fish species at WZZ. The marine ecosystem of WZZ was seriously destroyed initially in the 1970s-1980s and recovered in the 1990s, then constructed as the first national tropical marine ranch demonstration area of China in 2019. As fish is an important high trophic vertebrate in the marine ecosystem, understanding the composition and distribution of fish species could help us to recognise the status of the ecosystem of WZZ and supply scientific data for construction of the national marine ranch demonstration area. This study used eDNA technology to investigate the composition of fish community surrounding WZZ and provided a scientific basis for realising and protecting the marine ecosystem of the South China Sea.
The WZZ is an offshore island in the South China Sea, harbouring abundant marine fish resources. Although previous research investigated fish species of WZZ, the data were, however, still incomplete due to limitation of sampling methods and survey seasons. In this study, we intended to take advantage of eDNA and supplement data of fish species at WZZ as much as possible. Based on eDNA, this study provided the data on 188 fish species (including nine undetermined species denoted by genus sp.) belonging to 17 orders, 63 families and 124 genera and they were the more comprehensive records of fish species surrounding WZZ. In addition, the information on Molecular Operational Taxonomic Units (MOTUs) for taxon identification was also provided, aiming to contribute to the establishment of a specific eDNA taxon database for fish of the South China Sea. This study included two datasets, which were occurrences of fish taxa at WZZ, as well as MOTUs sequences and geographical coordinate information of sampling sites. The “fish taxon occurrences” dataset presented records on taxonomic, distribution and habitat conditions of 188 fish species detected using eDNA, as well as the latitude and longitude information of the sampling sites, the "MOTUs information" dataset provided the MOTUs sequences, source of sequences, abundance of sequences for 188 fish species, also included the species matched in NCBI and the best NCBI BLAST sequence similarity.
marine ecosystem, occurrence of fish taxon, distribution, sequences of MOTUs, the South China Sea
The Hainan Island is located in the South China Sea, covers a land area of 35,400 km2, as well as having a vast sea area of nearly 2 million km2 and 1,618 km of coastline (
The Wuzhizhou Island (WZZ) of Sanya City is an outlying island of Hainan Island, with an area of 1.48 km2 and 5.7 km of coastline, charmingly resembling an irregular butterfly in shape (
The environmental DNA (eDNA) has been known as a useful tool to detect aquatic and semi-aquatic species by extracting DNA from environmental samples such as water and sediment (
The sea area surrounding WZZ is located in Haitang Bay, coastal Sanya City, Hainan Province, China.
The sampling protocols referenced our previous research (
The eDNA was extracted using E.Z.N.A. Water DNA Kit and protocols of the kit were followed. Before DNA extraction, the experimental bench and equipment were regularly cleaned using 5% bleach and then 75% ethanol, in order to prevent cross-contamination. The extracted DNA samples were stored at -20°C for subsequent experiments. PCR amplification was performed using "MiFish-U" primer sets for multiple fish species detection (Forward: GTCGGTAAAACTCGTGCCAGC, Reverse: CATAGTGGGGTATCTAATCCCAGTTTG) (
Sample ID | Forward Oligo Tags | Reverse Oligo Tags |
2023-WZZD-1 | TAACGA | CGCTT |
2023-WZZD-2 | TAACGA | GCCAGT |
2023-WZZD-3 | TAACGA | TCTCAGTC |
2023-WZZD-4 | TAACGA | CGCTGAT |
2023-WZZD-5 | AACCGAGA | TCACC |
2023-WZZD-6 | AACCGAGA | ATGCCT |
2023-WZZD-NTC | AACCGAGA | CGCTT |
The original sequences obtained from the Illumina Novaseq platform were initially processed using QIIME 2 software (
We surveyed six localities in the sea area surrounding WZZ (Fig.
18.304 and 18.316 Latitude; 109.759 and 109.773 Longitude.
In total, two classes, 17 orders, 63 families, 124 genera and 188 fish species (including nine undetermined species denoted by genus sp.), were detected using eDNA in the area surrounding WZZ.
Rank | Scientific Name |
---|---|
class | Chondrichthyes |
class | Osteichthyes |
order | Anguilliformes |
order | Atheriniformes |
order | Aulopiformes |
order | Beloniformes |
order | Beryciformes |
order | Carcharhiniformes |
order | Clupeiformes |
order | Elopiformes |
order | Gadiformes |
order | Gasterosteiformes |
order | Mugiliformes |
order | Myliobatiformes |
order | Perciformes |
order | Pleuronectiformes |
order | Scorpaeniformes |
order | Siluriformes |
order | Tetraodontiformes |
family | Acanthuridae |
family | Acropomatidae |
family | Ambassidae |
family | Ammodytidae |
family | Apogonidae |
family | Atherinidae |
family | Balistidae |
family | Belonidae |
family | Blenniidae |
family | Bothidae |
family | Bregmacerotidae |
family | Caesionidae |
family | Callionymidae |
family | Carangidae |
family | Carcharhinidae |
family | Chaetodontidae |
family | Chirocentridae |
family | Cirrhitidae |
family | Clupeidae |
family | Cynoglossidae |
family | Elopidae |
family | Engraulidae |
family | Ephippidae |
family | Fistulariidae |
family | Gerreidae |
family | Gobiidae |
family | Haemulidae |
family | Hemiramphidae |
family | Holocentridae |
family | Kuhliidae |
family | Kyphosidae |
family | Labridae |
family | Latidae |
family | Leiognathidae |
family | Lethrinidae |
family | Lutjanidae |
family | Malacanthidae |
family | Monacanthidae |
family | Mugilidae |
family | Mullidae |
family | Muraenidae |
family | Myliobatidae |
family | Nemipteridae |
family | Ostraciidae |
family | Pempheridae |
family | Plesiopidae |
family | Plotosidae |
family | Pomacanthidae |
family | Pomacentridae |
family | Scaridae |
family | Scatophagidae |
family | Sciaenidae |
family | Scombridae |
family | Scorpaenidae |
family | Serranidae |
family | Siganidae |
family | Sillaginidae |
family | Sphyraenidae |
family | Synaphobranchidae |
family | Synodontidae |
family | Terapontidae |
family | Tetraodontidae |
family | Tripterygiidae |
genus | Abudefduf |
genus | Acanthurus |
genus | Acentrogobius |
genus | Acropoma |
genus | Aetobatus |
genus | Alepes |
genus | Aluterus |
genus | Ambassis |
genus | Ammodytes |
genus | Anampses |
genus | Andamia |
genus | Arothron |
genus | Atherinomorus |
genus | Bathygobius |
genus | Blenniella |
genus | Branchiostegus |
genus | Bregmaceros |
genus | Caesio |
genus | Callionymus |
genus | Cantherhines |
genus | Caranx |
genus | Carcharhinus |
genus | Centropyge |
genus | Cephalopholis |
genus | Chaetodon |
genus | Cheilinus |
genus | Chelon |
genus | Chirocentrus |
genus | Chrysiptera |
genus | Cirrhitus |
genus | Cirripectes |
genus | Clupanodon |
genus | Collichthys |
genus | Coris |
genus | Cromileptes |
genus | Cynoglossus |
genus | Decapterus |
genus | Dendrophysa |
genus | Diagramma |
genus | Dysomma |
genus | Echidna |
genus | Ellochelon |
genus | Elops |
genus | Encrasicholina |
genus | Engraulis |
genus | Engyprosopon |
genus | Enneapterygius |
genus | Entomacrodus |
genus | Epinephelus |
genus | Exallias |
genus | Favonigobius |
genus | Fistularia |
genus | Gazza |
genus | Gerres |
genus | Glossogobius |
genus | Gymnomuraena |
genus | Gymnothorax |
genus | Halichoeres |
genus | Helcogramma |
genus | Hemigymnus |
genus | Herklotsichthys |
genus | Hypoatherina |
genus | Hyporhamphus |
genus | Istiblennius |
genus | Istigobius |
genus | Kuhlia |
genus | Kyphosus |
genus | Lagocephalus |
genus | Lates |
genus | Lethrinus |
genus | Lutjanus |
genus | Moolgarda |
genus | Mugil |
genus | Mugilogobius |
genus | Myripristis |
genus | Neopomacentrus |
genus | Nuchequula |
genus | Odontamblyopus |
genus | Odonus |
genus | Oedalechilus |
genus | Osteomugil |
genus | Ostorhinchus |
genus | Ostracion |
genus | Parablennius |
genus | Parascorpaena |
genus | Parupeneus |
genus | Pelates |
genus | Pempheris |
genus | Platax |
genus | Plectroglyphidodon |
genus | Plesiops |
genus | Plotosus |
genus | Pomacentrus |
genus | Pomadasys |
genus | Pseudobalistes |
genus | Pseudogobius |
genus | Pterocaesio |
genus | Rastrelliger |
genus | Rhinecanthus |
genus | Salarias |
genus | Sardinella |
genus | Sardinops |
genus | Saurida |
genus | Scarus |
genus | Scatophagus |
genus | Scolopsis |
genus | Scomber |
genus | Secutor |
genus | Selar |
genus | Siganus |
genus | Sillago |
genus | Sphyraena |
genus | Spratelloides |
genus | Stethojulis |
genus | Stolephorus |
genus | Terapon |
genus | Thalassoma |
genus | Thryssa |
genus | Thunnus |
genus | Trachinotus |
genus | Trachurus |
genus | Tylosurus |
genus | Upeneus |
genus | Zenarchopterus |
species | Abudefduf notatus (Day, 1870) |
species | Abudefduf septemfasciatus (Cuvier, 1830) |
species | Abudefduf sexfasciatus (Lacépède, 1801) |
species | Abudefduf sordidus (Forsskål, 1775) |
species | Abudefduf vaigiensis (Quoy & Gaimard, 1825) |
species | Acanthurus triostegus (Linnaeus, 1758) |
species | Acentrogobius viganensis (Steindachner, 1893) |
species | Acropoma japonicum Günther, 1859 |
species | Aetobatus narinari (Euphrasen, 1790) |
species | Alepes djedaba (Forsskål, 1775) |
species | Alepes kleinii (Bloch, 1793) |
species | Alepes vari (Cuvier, 1833) |
species | Aluterus scriptus (Osbeck, 1765) |
species | Ambassis urotaenia Bleeker, 1852 |
species | Ammodytes personatus Girard, 1856 |
species | Anampses caeruleopunctatus Rüppell, 1829 |
species | Andamia tetradactylus (Bleeker, 1858) |
species | Arothron stellatus (Bloch & Schneider, 1801) |
species | Atherinomorus lacunosus (Forster, 1801) |
species | Atherinomorus regina (Seale, 1910) |
species | Bathygobius cotticeps (Steindachner, 1879) |
species | Bathygobius hongkongensis Lam, 1986 |
species | Blenniella bilitonensis (Bleeker, 1858) |
species | Branchiostegus argentatus (Cuvier, 1830) |
species | Bregmaceros mcclellandi Thompson, 1840 |
species | Caesio caerulaurea Lacépède, 1801 |
species | Callionymus meridionalis Suwardji, 1965 |
species | Cantherhines pardalis (Rüppell, 1837) |
species | Caranx sexfasciatus Quoy & Gaimard, 1825 |
species | Caranx tille Cuvier, 1833 |
species | Carcharhinus melanopterus (Quoy & Gaimard, 1824) |
species | Centropyge vrolikii (Bleeker, 1853) |
species | Cephalopholis argus Bloch & Schneider, 1801 |
species | Cephalopholis boenak (Bloch, 1790) |
species | Chaetodon auriga Forsskål, 1775 |
species | Chaetodon plebeius Cuvier, 1831 |
species | Chaetodon rafflesii Anonymous [Bennett], 1830 |
species | Chelon affinis (Günther, 1861) |
species | Chelon haematocheilus (Temminck & Schlegel, 1845) |
species | Chelon macrolepis (Smith, 1846) |
species | Chirocentrus dorab (Forsskål, 1775) |
species | Chrysiptera biocellata (Quoy & Gaimard, 1825) |
species | Chrysiptera brownriggii (Bennett, 1828) |
species | Chrysiptera glauca (Cuvier, 1830) |
species | Chrysiptera unimaculata (Cuvier, 1830) |
species | Cirrhitus pinnulatus (Forster, 1801) |
species | Cirripectes imitator Williams, 1985 |
species | Clupanodon thrissa (Linnaeus, 1758) |
species | Collichthys lucidus (Richardson, 1844) |
species | Coris gaimard (Quoy & Gaimard, 1824) |
species | Cromileptes altivelis (Valenciennes, 1828) |
species | Cynoglossus robustus Günther, 1873 |
species | Decapterus macrosoma Bleeker, 1851 |
species | Decapterus maruadsi (Temminck & Schlegel, 1843) |
species | Dendrophysa russelii (Cuvier, 1829) |
species | Diagramma melanacrum Johnson & Randall, 2001 |
species | Dysomma anguillare Barnard, 1923 |
species | Echidna nebulosa (Ahl, 1789) |
species | Echidna polyzona (Richardson, 1845) |
species | Ellochelon vaigiensis (Quoy & Gaimard, 1825) |
species | Elops machnata (Forsskål, 1775) |
species | Encrasicholina heteroloba (Rüppell, 1837) |
species | Encrasicholina punctifer Fowler, 1938 |
species | Engyprosopon multisquama Amaoka, 1963 |
species | Enneapterygius bahasa Fricke, 1997 |
species | Enneapterygius philippinus (Peters, 1868) |
species | Entomacrodus caudofasciatus (Regan, 1909) |
species | Entomacrodus decussatus (Bleeker, 1858) |
species | Entomacrodus striatus (Valenciennes, 1836) |
species | Entomacrodus thalassinus (Jordan & Seale, 1906) |
species | Epinephelus fuscoguttatus (Forsskål, 1775) |
species | Epinephelus multinotatus (Peters, 1876) |
species | Epinephelus trimaculatus (Valenciennes, 1828) |
species | Exallias brevis (Kner, 1868) |
species | Favonigobius reichei (Bleeker, 1854) |
species | Fistularia commersonii Rüppell, 1838 |
species | Gazza minuta (Bloch, 1795) |
species | Gerres erythrourus (Bloch, 1791) |
species | Gerres filamentosus Cuvier, 1829 |
species | Gerres oyena (Forsskål, 1775) |
species | Glossogobius celebius (Valenciennes, 1837) |
species | Gymnomuraena zebra (Shaw, 1797) |
species | Gymnothorax chilospilus Bleeker, 1864 |
species | Gymnothorax fimbriatus (Bennett, 1832) |
species | Gymnothorax flavimarginatus (Rüppell, 1830) |
species | Gymnothorax kidako (Temminck & Schlegel, 1846) |
species | Gymnothorax pictus (Ahl, 1789) |
species | Gymnothorax undulatus (Lacépède, 1803) |
species | Halichoeres argus (Bloch & Schneider, 1801) |
species | Halichoeres marginatus Rüppell, 1835 |
species | Helcogramma fuscipectoris (Fowler, 1946) |
species | Hemigymnus melapterus (Bloch, 1791) |
species | Herklotsichthys quadrimaculatus (Rüppell, 1837) |
species | Hypoatherina temminckii (Bleeker, 1854) |
species | Hyporhamphus dussumieri (Valenciennes, 1847) |
species | Istiblennius dussumieri (Valenciennes, 1836) |
species | Istiblennius edentulus (Forster & Schneider, 1801) |
species | Istigobius ornatus (Rüppell, 1830) |
species | Kuhlia mugil (Forster, 1801) |
species | Kyphosus bigibbus Lacépède, 1801 |
species | Kyphosus cinerascens (Forsskål, 1775) |
species | Kyphosus vaigiensis (Quoy & Gaimard, 1825) |
species | Lagocephalus spadiceus (Richardson, 1845) |
species | Lates calcarifer (Bloch, 1790) |
species | Lethrinus atkinsoni Seale, 1910 |
species | Lethrinus harak (Forsskål, 1775) |
species | Lethrinus nebulosus (Forsskål, 1775) |
species | Lethrinus ornatus Valenciennes, 1830 |
species | Lethrinus xanthochilus Klunzinger, 1870 |
species | Lutjanus argentimaculatus (Forsskål, 1775) |
species | Lutjanus fulviflamma (Forsskål, 1775) |
species | Lutjanus malabaricus (Bloch & Schneider, 1801) |
species | Lutjanus monostigma (Cuvier, 1828) |
species | Lutjanus stellatus Akazaki, 1983 |
species | Moolgarda seheli (Forsskål, 1775) |
species | Mugil cephalus Linnaeus, 1758 |
species | Mugilogobius chulae (Smith, 1932) |
species | Myripristis kuntee Valenciennes, 1831 |
species | Neopomacentrus cyanomos (Bleeker, 1856) |
species | Nuchequula nuchalis (Temminck & Schlegel, 1845) |
species | Odontamblyopus lacepedii (Temminck & Schlegel, 1845) |
species | Odonus niger (Rüppell, 1836) |
species | Oedalechilus labiosus (Valenciennes, 1836) |
species | Osteomugil speigleri (Bleeker, 1858) |
species | Ostorhinchus cookii (Macleay, 1881) |
species | Ostorhinchus fasciatus (White, 1790) |
species | Ostracion cubicus Linnaeus, 1758 |
species | Parablennius yatabei (Jordan & Snyder, 1900) |
species | Parascorpaena mossambica (Peters, 1855) |
species | Parupeneus ciliatus (Lacépède, 1802) |
species | Pelates quadrilineatus (Bloch, 1790) |
species | Pempheris adusta Bleeker, 1877 |
species | Pempheris xanthoptera Tominaga, 1963 |
species | Platax teira (Forsskål, 1775) |
species | Plectroglyphidodon dickii (Liénard, 1839) |
species | Plectroglyphidodon leucozonus (Bleeker, 1859) |
species | Plectroglyphidodon obreptus (Whitley, 1948) |
species | Plesiops coeruleolineatus Rüppell, 1835 |
species | Plotosus lineatus (Thunberg, 1787) |
species | Pomacentrus chrysurus Cuvier, 1830 |
species | Pomadasys maculatus (Bloch, 1793) |
species | Pseudobalistes flavimarginatus (Rüppell, 1829) |
species | Pseudogobius javanicus (Bleeker, 1856) |
species | Pterocaesio digramma (Bleeker, 1864) |
species | Rastrelliger kanagurta (Cuvier, 1816) |
species | Rhinecanthus aculeatus (Linnaeus, 1758) |
species | Salarias fasciatus (Bloch, 1786) |
species | Sardinella gibbosa (Bleeker, 1849) |
species | Sardinella lemuru Bleeker, 1853 |
species | Sardinops sagax (Jenyns, 1842) |
species | Saurida undosquamis (Richardson, 1848) |
species | Scarus psittacus Forsskål, 1775 |
species | Scarus rivulatus Valenciennes, 1840 |
species | Scatophagus argus (Linnaeus, 1766) |
species | Scolopsis ciliata (Lacépède, 1802) |
species | Scomber japonicus Houttuyn, 1782 |
species | Secutor ruconius (Hamilton, 1822) |
species | Selar crumenophthalmus (Bloch, 1793) |
species | Siganus canaliculatus (Park, 1797) |
species | Siganus fuscescens (Houttuyn, 1782) |
species | Siganus guttatus (Bloch, 1787) |
species | Siganus spinus (Linnaeus, 1758) |
species | Sillago sihama (Forsskål, 1775) |
species | Sphyraena jello Cuvier, 1829 |
species | Spratelloides delicatulus (Bennett, 1832) |
species | Spratelloides gracilis (Temminck & Schlegel, 1846) |
species | Stethojulis bandanensis (Bleeker, 1851) |
species | Stethojulis terina Jordan & Snyder, 1902 |
species | Stethojulis trilineata (Bloch & Schneider, 1801) |
species | Stolephorus waitei Jordan & Seale, 1926 |
species | Terapon jarbua (Forsskål, 1775) |
species | Thryssa kammalensis (Bleeker, 1849) |
species | Thunnus tonggol (Bleeker, 1851) |
species | Trachinotus baillonii (Lacépède, 1801) |
species | Trachinotus ovatus (Linnaeus, 1758) |
species | Trachurus japonicus (Temminck & Schlegel, 1844) |
species | Tylosurus crocodilus (Péron & Lesueur, 1821) |
species | Upeneus japonicus (Houttuyn, 1782) |
species | Zenarchopterus dunckeri Mohr, 1926 |
species | Cheilinus sp. |
species | Engraulis sp. |
species | Enneapterygius sp. |
species | Gymnomuraena sp. |
species | Ostorhinchus sp. |
species | Platax sp. |
species | Sardinella sp. |
species | Siganus sp. |
species | Thalassoma sp. |
The dataset presents the results of 188 fish species detected by eDNA at six sampling localities surrounding WZZ and includes the latitude and longitude information of the sampling sites. Important information including the taxonomic, geographic location of the occurrence and habitat condition was provided (Suppl. material
Column label | Column description |
---|---|
occurrenceID | Unique occurrence identifier. |
scientificName | The full scientific name. |
kingdom | The full scientific name of the kingdom in which the taxon is classified. |
Phylum | The full scientific name of the phylum or division in which the taxon is classified. |
Class | The full scientific name of the class in which the taxon is classified. |
Order | The full scientific name of the order in which the taxon is classified. |
Family | The full scientific name of the family in which the taxon is classified. |
Genus | The full scientific name of the genus in which the taxon is classified. |
taxonRank | The taxonomic rank of the most specific name in the scientificName as it appears in the original record. |
locality | The specific description of the county from where specimens are collected. |
county | The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the Location occurs. |
stateProvince | The name of the next smallest administrative region than country (state, province, canton, department, region etc.) in which the Location occurs. |
Country | The full, unabbreviated name of the country where the organism was collected. |
waterBody | The name of the water body in which the Location occurs. |
habitat | A category or description of the habitat in which the Event occurred. |
locationID | A spatial region or named place. The locationID refers to serial number of each sampling site in this study. |
decimalLatitude | The geographic latitude (in decimal degrees, using the spatial reference system given in geodeticDatum) of the geographic centre of a Location. |
decimalLongitude | The geographic longitude (in decimal degrees, using the spatial reference system given in geodeticDatum) of the geographic centre of a Location. |
geodeticDatum | The geographic information system (GIS) upon which the geographic coordinates given in decimalLatitude, decimalLongitude and meterElevation are based. |
basisOfRecord | The specific nature of the data record. |
eventDate | The date-time or interval during which a dwc:Event occurred. For occurrences, this is the date-time when the dwc:Event was recorded. Not suitable for a time in a geological context. |
samplingProtocol | The names of, references to, or descriptions of the methods or protocols used during a dwc:Event. |
The dataset presents the nucleotides sequence, sequences source and abundance of sequences of each MOTU, as well as its matched species in NCBI (https://www.ncbi.nlm.nih.gov/BLAST) and the best NCBI BLAST sequence similarity, obtained through high-throughput sequencing, based eDNA samples collected from the sea area surrounding WZZ (Suppl. material
Column label | Column description |
---|---|
scientificName | The full scientific name. |
associatedSequences | A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of genetic sequence information associated with the Occurrence. The associatedSequences refers to MOTUs sequences of each scientificName. |
organismQuantity | A number or enumeration value for the quantity of organisms. |
organismQuantityType | The type of quantification system used for the quantity of organisms. |
dateIdentified | The date on which the subject was determined as representing the Taxon. |
identificationReferences | A list (concatenated and separated) of references (publication, global unique identifier, URI) used in the Identification. |
identificationRemarks | Comments or notes about the Identification. |
A total of 188 fish species (including nine undetermined species denoted by genus sp.) were detected using eDNA surrounding WZZ and fish fauna was analysed (Fig.
We compared the fish species richness detected by eDNA to that by fishing nets, in order to assess the effects of eDNA on species identification. A total of 115 fish species belonging to 11 orders and 49 families, as well as a total of 174 fish species belonging to two classes, 12 orders, 65 families and 123 genera were investigated at WZZ through trawl nets in 2019 and 2020-2021, respectively (
This study is funded by the Key Research and Development Programme of the Hainan Province (No.ZDYF2022SHFZ027), the Hainan Provincial Joint Project of Sanya-Yazhou Bay Science and Technology City Grant (No.320LH069) and Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO.2023TD12). We appreciated help from the Hainan Wuzhizhou Tourism Development Co., Ltd during water sampling.
Chongzhao Wang prepared datasets, analysed data and drafted the manuscript. Zhenhua Ma, Xin Wang, Kun Cao and Yingchun Xing performed the fieldwork. Rui Xi, Ting Jiang and Rui Yang performed eDNA laboratory work. All co-authors gave their comments on this manuscript.
The dataset presents the results of 188 fish species detected by eDNA at six sampling localities surrounding WZZ, also above the latitude and longitude information of the sampling sites. The important information including taxonomic, geographic location of the occurrence and habitat condition was provided.
The dataset presents the nucleotides sequence, source of sequences and abundance of sequences of each MOTU, as well as its matched species in NCBI (https://www.ncbi.nlm.nih.gov/BLAST) and the best NCBI BLAST sequence similarity, obtained through high-throughput sequencing based eDNA samples collected from the area surrounding WZZ.