Biodiversity Data Journal : Data Paper (Biosciences)
PDF
Data Paper (Biosciences)
Species diversity of fish at the Wuzhizhou Island, South China Sea, based on environmental DNA
expand article infoChongzhao Wang‡,§,|, Zhenhua Ma, Kun Cao‡,§, Xin Wang§,|, Rui Xi§,|, Ting Jiang§,|, Rui Yang§,, Yingchun Xing‡,§
‡ Hainan Fisheries Innovation Research Institute, Chinese Academy of Fishery Sciences, Sanya 572024, China
§ Resource and Environmental Research Center, Chinese Academy of Fishery Sciences, Beijing 100141, China
| National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
¶ Tropical Aquaculture Research and Development Center, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Sanya 572018, China
Corresponding author: Yingchun Xing (xingych@cafs.ac.cn)
Academic editor: Yahui Zhao
Received: 08 May 2024 | Accepted: 06 Jun 2024 | Published: 14 Jun 2024
© 2024 Chongzhao Wang, Zhenhua Ma, Kun Cao, Xin Wang, Rui Xi, Ting Jiang, Rui Yang, Yingchun Xing
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Wang C, Ma Z, Cao K, Wang X, Xi R, Jiang T, Yang R, Xing Y (2024) Species diversity of fish at the Wuzhizhou Island, South China Sea, based on environmental DNA. Biodiversity Data Journal 12: e127120. https://doi.org/10.3897/BDJ.12.e127120
 Open Access

Abstract

Background

Wuzhizhou Island (WZZ) is located in Haitang Bay in the northern region of Sanya, Hainan Island. The sea area surrounding WZZ represents a typical tropical marine ecosystem, characterised by diverse and complex habitats. Therefore, there is a rich variety of marine fish species at WZZ. The marine ecosystem of WZZ was seriously destroyed initially in the 1970s-1980s and recovered in the 1990s, then constructed as the first national tropical marine ranch demonstration area of China in 2019. As fish is an important high trophic vertebrate in the marine ecosystem, understanding the composition and distribution of fish species could help us to recognise the status of the ecosystem of WZZ and supply scientific data for construction of the national marine ranch demonstration area. This study used eDNA technology to investigate the composition of fish community surrounding WZZ and provided a scientific basis for realising and protecting the marine ecosystem of the South China Sea.

New information

The WZZ is an offshore island in the South China Sea, harbouring abundant marine fish resources. Although previous research investigated fish species of WZZ, the data were, however, still incomplete due to limitation of sampling methods and survey seasons. In this study, we intended to take advantage of eDNA and supplement data of fish species at WZZ as much as possible. Based on eDNA, this study provided the data on 188 fish species (including nine undetermined species denoted by genus sp.) belonging to 17 orders, 63 families and 124 genera and they were the more comprehensive records of fish species surrounding WZZ. In addition, the information on Molecular Operational Taxonomic Units (MOTUs) for taxon identification was also provided, aiming to contribute to the establishment of a specific eDNA taxon database for fish of the South China Sea. This study included two datasets, which were occurrences of fish taxa at WZZ, as well as MOTUs sequences and geographical coordinate information of sampling sites. The “fish taxon occurrences” dataset presented records on taxonomic, distribution and habitat conditions of 188 fish species detected using eDNA, as well as the latitude and longitude information of the sampling sites, the "MOTUs information" dataset provided the MOTUs sequences, source of sequences, abundance of sequences for 188 fish species, also included the species matched in NCBI and the best NCBI BLAST sequence similarity.

Keywords

marine ecosystem, occurrence of fish taxon, distribution, sequences of MOTUs, the South China Sea

Introduction

The Hainan Island is located in the South China Sea, covers a land area of 35,400 km2, as well as having a vast sea area of nearly 2 million km2 and 1,618 km of coastline (Lin et al. 2022). The coastal area of the Hainan Island is rich in habitats such as rocky, coral reefs, gravel as well as sandy and muddy substrates (Liu 2013), which breed complex biological communities and high biodiversity. The marine fish, as an important part of the marine ecosystem, plays a key role in material cycling and energy flow, as well as maintaining the ecological functions (Ault et al. 2022, Ziegler et al. 2023). Therefore, the study of fish diversity in specific marine areas is essential for monitoring and evaluating the status of the ecosystem and it is able to offer valuable insights for marine ecological restoration and protection (Zou et al. 2020).

The Wuzhizhou Island (WZZ) of Sanya City is an outlying island of Hainan Island, with an area of 1.48 km2 and 5.7 km of coastline, charmingly resembling an irregular butterfly in shape (Luo et al. 2023). WZZ is located at Haitang Bay, affected by the tropical monsoon climate (Yin et al. 2023) and its northern coast is sandy and the southern coast is mainly rocky (Xu et al. 2020). Consequently, the water area at WZZ is distributed by abundant marine fish resources. With the exploitation of WZZ over the past decades, its ecosystem was significantly damaged by human activities, such as overfishing, land reclamation, coral mining, dredging, aquaculture expansion and pollution (Zhang et al. 2006). However, these negative effects began to be eliminated in 1997 when the Wuzhizhou Company initiated tourism development on the Island (Huang et al. 2020). In 2010, WZZ embarked on a marine ranch construction project, leading to the recognition of it as the first national-level marine ranch demonstration area in Hainan Province by 2019 (Li et al. 2015, Wang et al. 2021, Luo et al. 2023). At present, the studies on fish diversity of WZZ are to be conducted, aimed to understand the status of fish species diversity and evaluate the effectiveness of the sea ranch.

The environmental DNA (eDNA) has been known as a useful tool to detect aquatic and semi-aquatic species by extracting DNA from environmental samples such as water and sediment (Rees et al. 2014, Pedersen et al. 2015). Indeed, this technique has been widely used to monitor marine fish species, especially tropical marine biodiversity (Gelis et al. 2021, Mathon et al. 2022, Xi et al. 2022, Zhang et al. 2023). Compared to major traditional marine monitoring methods, such as fishing nets and diving, eDNA could provide more species information and less harm to the wildlife (Jerde et al. 2011, Sales et al. 2021). This study applied eDNA technology to provide valuable data that enrich the database of tropical marine fish, which would be a benefit for protecting the ecosystem of the South China Sea.

Sampling methods

Description: 

The sea area surrounding WZZ is located in Haitang Bay, coastal Sanya City, Hainan Province, China.

Sampling description: 

The sampling protocols referenced our previous research (Xing et al. 2022) and the main steps were as follows: the shallow seawater samples were collected using a 3 l hydrophore at six sampling sites in sea area surrounding WZZ in June 2022, as well as January and September 2023, the Hainan Province, China (Fig. 1). The distance between two sampling sites was more than 1 km. The three replicated 1 l water samples were collected at each sampling site (Fig. 2). The eDNA was collected by 0.45 µm MCE membrane filtration (Pall Whatman, UK) from water samples and each membrane enriched with DNA was stored individually in a 2 ml centrifuge tube at -10℃ in the field. Meanwhile, 300 ml purified water was filtered to serve as a negative control in order to detect contamination.

Figure 1.  

Location of eDNA sampling sites.

Figure 2.  

Photographs of marine habitats and field sampling around WZZ.

Step description: 

The eDNA was extracted using E.Z.N.A. Water DNA Kit and protocols of the kit were followed. Before DNA extraction, the experimental bench and equipment were regularly cleaned using 5% bleach and then 75% ethanol, in order to prevent cross-contamination. The extracted DNA samples were stored at -20°C for subsequent experiments. PCR amplification was performed using "MiFish-U" primer sets for multiple fish species detection (Forward: GTCGGTAAAACTCGTGCCAGC, Reverse: CATAGTGGGGTATCTAATCCCAGTTTG) (Miya et al. 2015). Both forward and reverse primers were tagged with oligonucleotide designed by the Shanghai Biozeron Biotechnology Co. Ltd, China and each sample had a specific tag (Table 1). A PCR system was total 25 µl volume, containing 4 µl of 5×FastPfu Buffer, 2 µl of 2.5 mM dNTPs, 0.8 µl Forward Primer (5 μM), 0.8 µl Reverse Primer(5 μM), 0.4 µl FastPfu Polymerase, 10 ng of Template DNA and 12 µl ddH®2O. The PCR reaction conditions were the following: pre-denaturation for 5 min at 95℃, followed by 32 cycles of denaturation (30 sec at 95℃), annealing (30 sec at 55℃) and elongation (45 sec at 72℃) and final elongation for 10 min at 72℃. And two negative controls (PCR blank) were set up in each PCR reaction, in order to monitor cross-contamination. The PCR products at each sampling site were verified at 2%. The libraries were built and then sequenced on an Illumina Novaseq platform (the Shanghai Biozeron Biotechnology Co. Ltd, China) using 150 bp paired-end sequencing.

Table 1.
Download as
CSV
XLSX

The oligo tag sequences corresponding to the samples.

Sample ID Forward Oligo Tags Reverse Oligo Tags
2023-WZZD-1 TAACGA CGCTT
2023-WZZD-2 TAACGA GCCAGT
2023-WZZD-3 TAACGA TCTCAGTC
2023-WZZD-4 TAACGA CGCTGAT
2023-WZZD-5 AACCGAGA TCACC
2023-WZZD-6 AACCGAGA ATGCCT
2023-WZZD-NTC AACCGAGA CGCTT

The original sequences obtained from the Illumina Novaseq platform were initially processed using QIIME 2 software (Bolyen et al. 2019) and the end sequences demultiplexed, based on the tags and primers were removed from the end. The reads were then trimmed to 160-180 bp using CUTADAPT software (Martin 2011). Next, the data obtained by sequencing were spliced and filtered in order to obtain high-quality sequences, which were clustered into MOTUs using VSEARCH software with 97% similarity (Zhang et al. 2019). Finally, the sequences of MOTUs were aligned with NCBI-BLAST (https://www.ncbi.nlm.nih.gov/BLAST, version in March 2024) under the default parameter settings for taxonomic annotation (Djurhuus et al. 2017). We used the following criteria for taxonomic assignment: a) if the query sequence matched one locally occurring species in the NCBI database (https://www.ncbi.nlm.nih.gov) with ≥ 97% identity, the species was assigned, b) if the query sequence matched more than one locally occurring species in the NCBI with ≥ 97% identity, the lowest taxonomic level (i.e. genus or family) that contains all these species was assigned, c) if the query sequence matched a non-native species in the NCBI with ≥ 97% identity, meanwhile this non-native species belonged to the same genus as the known native species, this genus was assigned. The sequences assigned to “NA” or assigned to humans, birds, mammals or amphibians were removed. The geographical distribution of each species was verified by the Species Catalogue of China. Volume 2, Animals, Vertebrates. V (Zhang et al. 2020) and the FishBase database (http://www.fishbase.org/search.php).

Geographic coverage

Description: 

We surveyed six localities in the sea area surrounding WZZ (Fig. 1). The investigation involved nearly 249325.426 m² measured using ArcGIS 10.8 software.

Coordinates: 

18.304 and 18.316 Latitude; 109.759 and 109.773 Longitude.

Taxonomic coverage

Description: 

In total, two classes, 17 orders, 63 families, 124 genera and 188 fish species (including nine undetermined species denoted by genus sp.), were detected using eDNA in the area surrounding WZZ.

Taxa included:
Rank Scientific Name
class Chondrichthyes
class Osteichthyes
order Anguilliformes
order Atheriniformes
order Aulopiformes
order Beloniformes
order Beryciformes
order Carcharhiniformes
order Clupeiformes
order Elopiformes
order Gadiformes
order Gasterosteiformes
order Mugiliformes
order Myliobatiformes
order Perciformes
order Pleuronectiformes
order Scorpaeniformes
order Siluriformes
order Tetraodontiformes
family Acanthuridae
family Acropomatidae
family Ambassidae
family Ammodytidae
family Apogonidae
family Atherinidae
family Balistidae
family Belonidae
family Blenniidae
family Bothidae
family Bregmacerotidae
family Caesionidae
family Callionymidae
family Carangidae
family Carcharhinidae
family Chaetodontidae
family Chirocentridae
family Cirrhitidae
family Clupeidae
family Cynoglossidae
family Elopidae
family Engraulidae
family Ephippidae
family Fistulariidae
family Gerreidae
family Gobiidae
family Haemulidae
family Hemiramphidae
family Holocentridae
family Kuhliidae
family Kyphosidae
family Labridae
family Latidae
family Leiognathidae
family Lethrinidae
family Lutjanidae
family Malacanthidae
family Monacanthidae
family Mugilidae
family Mullidae
family Muraenidae
family Myliobatidae
family Nemipteridae
family Ostraciidae
family Pempheridae
family Plesiopidae
family Plotosidae
family Pomacanthidae
family Pomacentridae
family Scaridae
family Scatophagidae
family Sciaenidae
family Scombridae
family Scorpaenidae
family Serranidae
family Siganidae
family Sillaginidae
family Sphyraenidae
family Synaphobranchidae
family Synodontidae
family Terapontidae
family Tetraodontidae
family Tripterygiidae
genus Abudefduf
genus Acanthurus
genus Acentrogobius
genus Acropoma
genus Aetobatus
genus Alepes
genus Aluterus
genus Ambassis
genus Ammodytes
genus Anampses
genus Andamia
genus Arothron
genus Atherinomorus
genus Bathygobius
genus Blenniella
genus Branchiostegus
genus Bregmaceros
genus Caesio
genus Callionymus
genus Cantherhines
genus Caranx
genus Carcharhinus
genus Centropyge
genus Cephalopholis
genus Chaetodon
genus Cheilinus
genus Chelon
genus Chirocentrus
genus Chrysiptera
genus Cirrhitus
genus Cirripectes
genus Clupanodon
genus Collichthys
genus Coris
genus Cromileptes
genus Cynoglossus
genus Decapterus
genus Dendrophysa
genus Diagramma
genus Dysomma
genus Echidna
genus Ellochelon
genus Elops
genus Encrasicholina
genus Engraulis
genus Engyprosopon
genus Enneapterygius
genus Entomacrodus
genus Epinephelus
genus Exallias
genus Favonigobius
genus Fistularia
genus Gazza
genus Gerres
genus Glossogobius
genus Gymnomuraena
genus Gymnothorax
genus Halichoeres
genus Helcogramma
genus Hemigymnus
genus Herklotsichthys
genus Hypoatherina
genus Hyporhamphus
genus Istiblennius
genus Istigobius
genus Kuhlia
genus Kyphosus
genus Lagocephalus
genus Lates
genus Lethrinus
genus Lutjanus
genus Moolgarda
genus Mugil
genus Mugilogobius
genus Myripristis
genus Neopomacentrus
genus Nuchequula
genus Odontamblyopus
genus Odonus
genus Oedalechilus
genus Osteomugil
genus Ostorhinchus
genus Ostracion
genus Parablennius
genus Parascorpaena
genus Parupeneus
genus Pelates
genus Pempheris
genus Platax
genus Plectroglyphidodon
genus Plesiops
genus Plotosus
genus Pomacentrus
genus Pomadasys
genus Pseudobalistes
genus Pseudogobius
genus Pterocaesio
genus Rastrelliger
genus Rhinecanthus
genus Salarias
genus Sardinella
genus Sardinops
genus Saurida
genus Scarus
genus Scatophagus
genus Scolopsis
genus Scomber
genus Secutor
genus Selar
genus Siganus
genus Sillago
genus Sphyraena
genus Spratelloides
genus Stethojulis
genus Stolephorus
genus Terapon
genus Thalassoma
genus Thryssa
genus Thunnus
genus Trachinotus
genus Trachurus
genus Tylosurus
genus Upeneus
genus Zenarchopterus
species Abudefduf notatus (Day, 1870)
species Abudefduf septemfasciatus (Cuvier, 1830)
species Abudefduf sexfasciatus (Lacépède, 1801)
species Abudefduf sordidus (Forsskål, 1775)
species Abudefduf vaigiensis (Quoy & Gaimard, 1825)
species Acanthurus triostegus (Linnaeus, 1758)
species Acentrogobius viganensis (Steindachner, 1893)
species Acropoma japonicum Günther, 1859
species Aetobatus narinari (Euphrasen, 1790)
species Alepes djedaba (Forsskål, 1775)
species Alepes kleinii (Bloch, 1793)
species Alepes vari (Cuvier, 1833)
species Aluterus scriptus (Osbeck, 1765)
species Ambassis urotaenia Bleeker, 1852
species Ammodytes personatus Girard, 1856
species Anampses caeruleopunctatus Rüppell, 1829
species Andamia tetradactylus (Bleeker, 1858)
species Arothron stellatus (Bloch & Schneider, 1801)
species Atherinomorus lacunosus (Forster, 1801)
species Atherinomorus regina (Seale, 1910)
species Bathygobius cotticeps (Steindachner, 1879)
species Bathygobius hongkongensis Lam, 1986
species Blenniella bilitonensis (Bleeker, 1858)
species Branchiostegus argentatus (Cuvier, 1830)
species Bregmaceros mcclellandi Thompson, 1840
species Caesio caerulaurea Lacépède, 1801
species Callionymus meridionalis Suwardji, 1965
species Cantherhines pardalis (Rüppell, 1837)
species Caranx sexfasciatus Quoy & Gaimard, 1825
species Caranx tille Cuvier, 1833
species Carcharhinus melanopterus (Quoy & Gaimard, 1824)
species Centropyge vrolikii (Bleeker, 1853)
species Cephalopholis argus Bloch & Schneider, 1801
species Cephalopholis boenak (Bloch, 1790)
species Chaetodon auriga Forsskål, 1775
species Chaetodon plebeius Cuvier, 1831
species Chaetodon rafflesii Anonymous [Bennett], 1830
species Chelon affinis (Günther, 1861)
species Chelon haematocheilus (Temminck & Schlegel, 1845)
species Chelon macrolepis (Smith, 1846)
species Chirocentrus dorab (Forsskål, 1775)
species Chrysiptera biocellata (Quoy & Gaimard, 1825)
species Chrysiptera brownriggii (Bennett, 1828)
species Chrysiptera glauca (Cuvier, 1830)
species Chrysiptera unimaculata (Cuvier, 1830)
species Cirrhitus pinnulatus (Forster, 1801)
species Cirripectes imitator Williams, 1985
species Clupanodon thrissa (Linnaeus, 1758)
species Collichthys lucidus (Richardson, 1844)
species Coris gaimard (Quoy & Gaimard, 1824)
species Cromileptes altivelis (Valenciennes, 1828)
species Cynoglossus robustus Günther, 1873
species Decapterus macrosoma Bleeker, 1851
species Decapterus maruadsi (Temminck & Schlegel, 1843)
species Dendrophysa russelii (Cuvier, 1829)
species Diagramma melanacrum Johnson & Randall, 2001
species Dysomma anguillare Barnard, 1923
species Echidna nebulosa (Ahl, 1789)
species Echidna polyzona (Richardson, 1845)
species Ellochelon vaigiensis (Quoy & Gaimard, 1825)
species Elops machnata (Forsskål, 1775)
species Encrasicholina heteroloba (Rüppell, 1837)
species Encrasicholina punctifer Fowler, 1938
species Engyprosopon multisquama Amaoka, 1963
species Enneapterygius bahasa Fricke, 1997
species Enneapterygius philippinus (Peters, 1868)
species Entomacrodus caudofasciatus (Regan, 1909)
species Entomacrodus decussatus (Bleeker, 1858)
species Entomacrodus striatus (Valenciennes, 1836)
species Entomacrodus thalassinus (Jordan & Seale, 1906)
species Epinephelus fuscoguttatus (Forsskål, 1775)
species Epinephelus multinotatus (Peters, 1876)
species Epinephelus trimaculatus (Valenciennes, 1828)
species Exallias brevis (Kner, 1868)
species Favonigobius reichei (Bleeker, 1854)
species Fistularia commersonii Rüppell, 1838
species Gazza minuta (Bloch, 1795)
species Gerres erythrourus (Bloch, 1791)
species Gerres filamentosus Cuvier, 1829
species Gerres oyena (Forsskål, 1775)
species Glossogobius celebius (Valenciennes, 1837)
species Gymnomuraena zebra (Shaw, 1797)
species Gymnothorax chilospilus Bleeker, 1864
species Gymnothorax fimbriatus (Bennett, 1832)
species Gymnothorax flavimarginatus (Rüppell, 1830)
species Gymnothorax kidako (Temminck & Schlegel, 1846)
species Gymnothorax pictus (Ahl, 1789)
species Gymnothorax undulatus (Lacépède, 1803)
species Halichoeres argus (Bloch & Schneider, 1801)
species Halichoeres marginatus Rüppell, 1835
species Helcogramma fuscipectoris (Fowler, 1946)
species Hemigymnus melapterus (Bloch, 1791)
species Herklotsichthys quadrimaculatus (Rüppell, 1837)
species Hypoatherina temminckii (Bleeker, 1854)
species Hyporhamphus dussumieri (Valenciennes, 1847)
species Istiblennius dussumieri (Valenciennes, 1836)
species Istiblennius edentulus (Forster & Schneider, 1801)
species Istigobius ornatus (Rüppell, 1830)
species Kuhlia mugil (Forster, 1801)
species Kyphosus bigibbus Lacépède, 1801
species Kyphosus cinerascens (Forsskål, 1775)
species Kyphosus vaigiensis (Quoy & Gaimard, 1825)
species Lagocephalus spadiceus (Richardson, 1845)
species Lates calcarifer (Bloch, 1790)
species Lethrinus atkinsoni Seale, 1910
species Lethrinus harak (Forsskål, 1775)
species Lethrinus nebulosus (Forsskål, 1775)
species Lethrinus ornatus Valenciennes, 1830
species Lethrinus xanthochilus Klunzinger, 1870
species Lutjanus argentimaculatus (Forsskål, 1775)
species Lutjanus fulviflamma (Forsskål, 1775)
species Lutjanus malabaricus (Bloch & Schneider, 1801)
species Lutjanus monostigma (Cuvier, 1828)
species Lutjanus stellatus Akazaki, 1983
species Moolgarda seheli (Forsskål, 1775)
species Mugil cephalus Linnaeus, 1758
species Mugilogobius chulae (Smith, 1932)
species Myripristis kuntee Valenciennes, 1831
species Neopomacentrus cyanomos (Bleeker, 1856)
species Nuchequula nuchalis (Temminck & Schlegel, 1845)
species Odontamblyopus lacepedii (Temminck & Schlegel, 1845)
species Odonus niger (Rüppell, 1836)
species Oedalechilus labiosus (Valenciennes, 1836)
species Osteomugil speigleri (Bleeker, 1858)
species Ostorhinchus cookii (Macleay, 1881)
species Ostorhinchus fasciatus (White, 1790)
species Ostracion cubicus Linnaeus, 1758
species Parablennius yatabei (Jordan & Snyder, 1900)
species Parascorpaena mossambica (Peters, 1855)
species Parupeneus ciliatus (Lacépède, 1802)
species Pelates quadrilineatus (Bloch, 1790)
species Pempheris adusta Bleeker, 1877
species Pempheris xanthoptera Tominaga, 1963
species Platax teira (Forsskål, 1775)
species Plectroglyphidodon dickii (Liénard, 1839)
species Plectroglyphidodon leucozonus (Bleeker, 1859)
species Plectroglyphidodon obreptus (Whitley, 1948)
species Plesiops coeruleolineatus Rüppell, 1835
species Plotosus lineatus (Thunberg, 1787)
species Pomacentrus chrysurus Cuvier, 1830
species Pomadasys maculatus (Bloch, 1793)
species Pseudobalistes flavimarginatus (Rüppell, 1829)
species Pseudogobius javanicus (Bleeker, 1856)
species Pterocaesio digramma (Bleeker, 1864)
species Rastrelliger kanagurta (Cuvier, 1816)
species Rhinecanthus aculeatus (Linnaeus, 1758)
species Salarias fasciatus (Bloch, 1786)
species Sardinella gibbosa (Bleeker, 1849)
species Sardinella lemuru Bleeker, 1853
species Sardinops sagax (Jenyns, 1842)
species Saurida undosquamis (Richardson, 1848)
species Scarus psittacus Forsskål, 1775
species Scarus rivulatus Valenciennes, 1840
species Scatophagus argus (Linnaeus, 1766)
species Scolopsis ciliata (Lacépède, 1802)
species Scomber japonicus Houttuyn, 1782
species Secutor ruconius (Hamilton, 1822)
species Selar crumenophthalmus (Bloch, 1793)
species Siganus canaliculatus (Park, 1797)
species Siganus fuscescens (Houttuyn, 1782)
species Siganus guttatus (Bloch, 1787)
species Siganus spinus (Linnaeus, 1758)
species Sillago sihama (Forsskål, 1775)
species Sphyraena jello Cuvier, 1829
species Spratelloides delicatulus (Bennett, 1832)
species Spratelloides gracilis (Temminck & Schlegel, 1846)
species Stethojulis bandanensis (Bleeker, 1851)
species Stethojulis terina Jordan & Snyder, 1902
species Stethojulis trilineata (Bloch & Schneider, 1801)
species Stolephorus waitei Jordan & Seale, 1926
species Terapon jarbua (Forsskål, 1775)
species Thryssa kammalensis (Bleeker, 1849)
species Thunnus tonggol (Bleeker, 1851)
species Trachinotus baillonii (Lacépède, 1801)
species Trachinotus ovatus (Linnaeus, 1758)
species Trachurus japonicus (Temminck & Schlegel, 1844)
species Tylosurus crocodilus (Péron & Lesueur, 1821)
species Upeneus japonicus (Houttuyn, 1782)
species Zenarchopterus dunckeri Mohr, 1926
species Cheilinus sp.
species Engraulis sp.
species Enneapterygius sp.
species Gymnomuraena sp.
species Ostorhinchus sp.
species Platax sp.
species Sardinella sp.
species Siganus sp.
species Thalassoma sp.

Temporal coverage

Data range: 
2022-6-26 - 2022-6-27; 2023-1-15 - 2023-1-17; 2023-9-06 - 2023-9-08.

Usage licence

Usage licence: 
Creative Commons Public Domain Waiver (CC-Zero)

Data resources

Data package title: 
Fish taxon-occurrences surrounding WZZ, Hainan Province, China based on eDNA
Number of data sets: 
2
Data set name: 
Fish taxon-occurrences surrounding WZZ detected by eDNA
Data format: 
Darwin Core
Description: 

The dataset presents the results of 188 fish species detected by eDNA at six sampling localities surrounding WZZ and includes the latitude and longitude information of the sampling sites. Important information including the taxonomic, geographic location of the occurrence and habitat condition was provided (Suppl. material 1).

Column label Column description
occurrenceID Unique occurrence identifier.
scientificName The full scientific name.
kingdom The full scientific name of the kingdom in which the taxon is classified.
Phylum The full scientific name of the phylum or division in which the taxon is classified.
Class The full scientific name of the class in which the taxon is classified.
Order The full scientific name of the order in which the taxon is classified.
Family The full scientific name of the family in which the taxon is classified.
Genus The full scientific name of the genus in which the taxon is classified.
taxonRank The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
locality The specific description of the county from where specimens are collected.
county The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the Location occurs.
stateProvince The name of the next smallest administrative region than country (state, province, canton, department, region etc.) in which the Location occurs.
Country The full, unabbreviated name of the country where the organism was collected.
waterBody The name of the water body in which the Location occurs.
habitat A category or description of the habitat in which the Event occurred.
locationID A spatial region or named place. The locationID refers to serial number of each sampling site in this study.
decimalLatitude The geographic latitude (in decimal degrees, using the spatial reference system given in geodeticDatum) of the geographic centre of a Location.
decimalLongitude The geographic longitude (in decimal degrees, using the spatial reference system given in geodeticDatum) of the geographic centre of a Location.
geodeticDatum The geographic information system (GIS) upon which the geographic coordinates given in decimalLatitude, decimalLongitude and meterElevation are based.
basisOfRecord The specific nature of the data record.
eventDate The date-time or interval during which a dwc:Event occurred. For occurrences, this is the date-time when the dwc:Event was recorded. Not suitable for a time in a geological context.
samplingProtocol The names of, references to, or descriptions of the methods or protocols used during a dwc:Event.
Data set name: 
MOTUs information of fish species detected by eDNA
Data format: 
Darwin Core
Description: 

The dataset presents the nucleotides sequence, sequences source and abundance of sequences of each MOTU, as well as its matched species in NCBI (https://www.ncbi.nlm.nih.gov/BLAST) and the best NCBI BLAST sequence similarity, obtained through high-throughput sequencing, based eDNA samples collected from the sea area surrounding WZZ (Suppl. material 2).

Column label Column description
scientificName The full scientific name.
associatedSequences A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of genetic sequence information associated with the Occurrence. The associatedSequences refers to MOTUs sequences of each scientificName.
organismQuantity A number or enumeration value for the quantity of organisms.
organismQuantityType The type of quantification system used for the quantity of organisms.
dateIdentified The date on which the subject was determined as representing the Taxon.
identificationReferences A list (concatenated and separated) of references (publication, global unique identifier, URI) used in the Identification.
identificationRemarks Comments or notes about the Identification.

Additional information

A total of 188 fish species (including nine undetermined species denoted by genus sp.) were detected using eDNA surrounding WZZ and fish fauna was analysed (Fig. 3). At the order level, Perciformes included the most species (n = 130), accounting for 69.15% of the total number of fish species detected and occupied absolute advantage compared to other orders. The Clupeiformes (n = 14) was the second largest order, accounting for 7.45%, followed by Anguilliformes (n = 11) accounting for 5.85%. Additionally, the Mugiliformes and Tetraodontiformes both had eight species, accounting for 4.26%, respectively. The Atheriniformes and Beloniformes both included three species, separately accounting for 1.60%, as well as the Pleuronectiformes containing two species and accounting for 1.06%. The rest of the orders, Aulopiformes, Beryciformes, Carcharhiniformes, Elopiformes, Gadiformes, Gasterosteiformes, Myliobatiformes, Scorpaeniformes and Siluriformes, all harboured only one species and 0.53% of the total number (Fig. 3). At the family level, the most dominant was Pomacentridae and it included 14 species, accounting for 7.45% of the total number. The second family is Blenniidae (n = 12, 6.38%), followed by Carangidae (n = 11, 5.85%). Most of the families had only one species (Fig. 3).

Figure 3.  

The composition of fish fauna surrounding WZZ at the order level (a) and family level (b).

We compared the fish species richness detected by eDNA to that by fishing nets, in order to assess the effects of eDNA on species identification. A total of 115 fish species belonging to 11 orders and 49 families, as well as a total of 174 fish species belonging to two classes, 12 orders, 65 families and 123 genera were investigated at WZZ through trawl nets in 2019 and 2020-2021, respectively (Wang et al. 2021, Luo et al. 2023). According to our results, the eDNA could supply more information of fish species, compared to traditional fishing nets. Meanwhile, the differences between the two monitoring methods in the number of family and order may be related to seasonal changes of the marine fish community. Although some species cannot be annotated using the NCBI database or only be identified at the genus level, based on MOTUs sequences, the eDNA datasets established in this study can help us to solve this problem to a certain extent.

Acknowledgements

This study is funded by the Key Research and Development Programme of the Hainan Province (No.ZDYF2022SHFZ027), the Hainan Provincial Joint Project of Sanya-Yazhou Bay Science and Technology City Grant (No.320LH069) and Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO.2023TD12). We appreciated help from the Hainan Wuzhizhou Tourism Development Co., Ltd during water sampling.

Author contributions

Chongzhao Wang prepared datasets, analysed data and drafted the manuscript. Zhenhua Ma, Xin Wang, Kun Cao and Yingchun Xing performed the fieldwork. Rui Xi, Ting Jiang and Rui Yang performed eDNA laboratory work. All co-authors gave their comments on this manuscript.

References

Supplementary materials

Suppl. material 1: Fish taxon-occurrences surrounding WZZ, Hainan Province, China based on eDNA 
Authors:  Chongzhao Wang, Zhenhua Ma, Kun Cao, Ting Jiang, Rui Yang, Rui Xi, Xin Wang, Yingchun Xing
Data type:  dataset
Brief description: 

The dataset presents the results of 188 fish species detected by eDNA at six sampling localities surrounding WZZ, also above the latitude and longitude information of the sampling sites. The important information including taxonomic, geographic location of the occurrence and habitat condition was provided.

Download file (240.04 kb)
Suppl. material 2: MOTUs information of marine fish detected by eDNA 
Authors:  Chongzhao Wang, Zhenhua Ma, Kun Cao, Ting Jiang, Rui Yang, Rui Xi, Xin Wang, Yingchun Xing
Data type:  dataset
Brief description: 

The dataset presents the nucleotides sequence, source of sequences and abundance of sequences of each MOTU, as well as its matched species in NCBI (https://www.ncbi.nlm.nih.gov/BLAST) and the best NCBI BLAST sequence similarity, obtained through high-throughput sequencing based eDNA samples collected from the area surrounding WZZ.

Download file (63.96 kb)
login to comment