Biodiversity Data Journal : Research Article
Print
Research Article
NGS-based biodiversity and community structure analysis of meiofaunal eukaryotes in shell sand from Hållö island, Smögen, and soft mud from Gullmarn Fjord, Sweden
expand article infoQuiterie Haenel, Oleksandr Holovachov§, Ulf Jondelius§, Per Sundberg|,, Sarah J. Bourlat|,
‡ Zoological Institute, University of Basel, Basel, Switzerland
§ Swedish Museum of Natural History, Stockholm, Sweden
| Department of Marine Sciences, University of Gothenburg, Gothenburg, Sweden
¶ SeAnalytics AB, Bohus-Björkö, Sweden
Open Access

Abstract

Aim: The aim of this study was to assess the biodiversity and community structure of Swedish meiofaunal eukaryotes using metabarcoding. To validate the reliability of the metabarcoding approach, we compare the taxonomic resolution obtained using the mitochondrial cytochrome oxidase 1 (COI) ‘mini-barcode’ and nuclear 18S small ribosomal subunit (18S) V1-V2 region, with traditional morphology-based identification of Xenacoelomorpha and Nematoda.

Location: 30 samples were analysed from two ecologically distinct locations along the west coast of Sweden. 18 replicate samples of coarse shell sand were collected along the north-eastern side of Hållö island near Smögen, while 12 replicate samples of soft mud were collected in the Gullmarn Fjord near Lysekil.

Methods: Meiofauna was extracted using flotation and siphoning methods. Both COI and 18S regions were amplified from total DNA samples using Metazoan specific primers and subsequently sequenced using Illumina MiSeq, producing in total 24 132 875 paired-end reads of 300 bp in length, of which 15 883 274 COI reads and 8 249 601 18S reads. These were quality filtered resulting in 7 954 017 COI sequences and 890 370 18S sequences, clustered into 2805 and 1472 representative OTUs respectively, yielding 190 metazoan OTUs for COI and 121 metazoan OTUs for 18S using a 97% sequence similarity threshold.

Results: The Metazoan fraction represents 7% of the total dataset for COI (190 OTUs) and 8% of sequences for 18S (121 OTUs). Annelida (30% of COI metazoan OTUs and 23.97% of 18S metazoan OTUs) and Arthropoda (27.37% of COI metazoan OTUs and 11.57% of 18S metazoan OTUs), were the most OTU rich phyla identified in all samples combined. As well as Annelida and Arthropoda, other OTU rich phyla represented in our samples include Mollusca, Platyhelminthes and Nematoda. In total, 213 COI OTUs and 243 18S OTUs were identified to species using a 97% sequence similarity threshold, revealing some non-native species and highlighting the potential of metabarcoding for biological recording. Taxonomic community composition shows as expected clear differentiation between the two habitat types (soft mud versus coarse shell sand), and diversity observed varies according to choice of meiofaunal sampling method and primer pair used.

Keywords

Meiofaunal biodiversity, community structure, Illumina Mi-Seq, Metabarcoding, COI, 18S

Introduction

Microscopic interstitial marine organisms, also termed ‘meiofauna’, are often defined as animals that pass a 1mm mesh but are retained on a 45 µm sieve (Higgins 1988). Meiofauna are an important component of sedimentary and benthic habitats due to their small size, abundance and rapid turnover rates. Moreover, meiofaunal surveys represent a useful tool for environmental impact assessments, underlying the urgent need for reliable, reproducible and rapid analytical methods. The breadth of taxonomic groups present in marine sediments makes meiofauna an ideal tool for detecting the effects of ecological impacts on marine biodiversity (Moreno et al. 2008). However, traditional morphology based taxonomy assignment methods are labour intensive and time consuming, leading us to explore recently developed metabarcoding methods for whole community analysis. Metabarcoding has previously been used to characterize plankton assemblages (Lindeque et al. 2013, de Vargas et al. 2015), marine benthic meiofaunal assemblages (Creer et al. 2010, Fonseca et al. 2014, Fonseca et al. 2010, Brannock and Halanych 2015, Cowart et al. 2015), meiofaunal communities colonizing autonomous reef monitoring structures (Leray and Knowlton 2015) or fish gut contents (Leray et al. 2013). The vast majority of studies have employed Roche 454 due to its long read lengths compared to other technologies (Table 1Shokralla et al. 2012), but Illumina MiSeq is now able to provide similarly long reads using paired-end sequencing (2x300 base pairs). As summarized in Table 1, there is no standardized method for metabarcoding of marine fauna, and a variety of sample extraction methods, sequencing platforms, molecular markers, bioinformatics pipelines and OTU clustering thresholds have been used to date, making these studies difficult to compare (Table 1).

Methodological comparison of benthic and pelagic metabarcoding studies of marine fauna published to date

Authors

Sample type

Sample extraction method

Sequencing platform

Marker

Marker size (bp)

Chimera screening

OTU clustering method and threshold

Database

Leray et al. 2013

Coral reef fish gut contents

Dissection of fish gut

Roche 454 GS FLX

COI

313

UCHIME

CROP

92-94%

Moorea Biocode Database, GenBank

Leray and Knowlton 2015

Autonomous reef monitoring structures

4 fractions (Sessile, 2mm, 500μm, 106μm)

Ion Torrent

COI

313

 

 

BOLD, GenBank

Lindeque et al. 2013

Zooplankton from 50m to the surface

200μm mesh WP2 plankton net

Roche 454 GS FLX

18S

(V1-V2 regions)

450

ChimeraSlayer

(QIIME 1.3.0)

UCLUST 97%

(QIIME 1.3.0)

Silva 108, GenBank

de Vargas et al. 2015

Plankton

3 fractions (5-20μm,

20-180μm, 180-2000μm)

Paired-end Illumina Genome Analyser IIx system

18S

(V9 region)

 

USEARCH

 

V9_PR2, V9 rDNA, Protistan Ribosomal Reference Database

Fonseca et al. 2010

Marine benthic meiofauna

Decanting

45μm sieve

Ludox

Roche 454 GS FLX

18S

(V1-V2 regions)

364

(250-500)

OCTOPUS

OCTOPUS 96%

GenBank

Fonseca et al. 2014

Marine benthic meiofauna

Decanting

45μm sieve

Ludox

Roche 454 GS FLX

18S

(V1-V2 regions)

450

Amplicon-Noise

Amplicon-Noise

99% and 96%

GenBank

Brannock and Halanych 2015

Marine benthic meiofauna

Directly from sediment, elutriated on 45μm sieve

Paired-end 100 bp reads Illumina HiSeq

18S

(V9 region)

87-187 [13]

USEARCH 6.1. (QIIME 1.8)

UPARSE 97%

UCLUST and USEARCH

(QIIME 1.8)

Silva 111

Cowart et al. 2015

Benthic meiofauna from seagrass meadows

2mm sieve, 1mm sieve, 0.5mm sieve

Roche 454 GS FLX

COI

18S

450

710

USEARCH 6.1

(QIIIME 1.7)

UCLUST de novo (QIIME 1.7)

GenBank

Silva 115

This study

Meiofauna from coarse shell sand and muddy benthic sediment

Siphoning 125μm,

flotation (MgCl2) 125μm,

flotation (H2O) 45μm/70μm

Paired-end Illumina Mi-Seq

COI

18S

(V1-V2 regions)

313

364

UCHIME

(part of USEARCH 6.1.)

(QIIME 1.9.1)

CROP

COI: 92-94%

18S: 95-97%

BOLD, SweBol and own databases for Nemertea, Acoela, Oligochaeta), Genbank

Silva 111

In this study we used samples from muddy and sandy marine sediments to examine how results of metabarcoding based surveys of meiofaunal communities are impacted by three different meiofaunal extraction methods and three different primer pairs for COI and 18S. In order to validate the reliability of the metabarcoding approach, we compare the results obtained with traditional morphology-based taxonomic assignment for two test groups, Xenacoelomorpha and Nematoda, the latter previously shown to be the dominant taxon in meiofaunal communities in terms of number of OTUs (Fonseca et al. 2010).

Materials and Methods

Sampling

Samples were collected in two ecologically distinct locations along the west coast of Sweden in August 2014.

Hållö island samples: Coarse shell sand was sampled by dredging at 7-8m depth along the north-eastern side of Hållö island near Smögen, Sotenäs municipality, Västra Götalands county (N 58° 20.32-20.38', E 11° 12.73-12.68').

Gullmarn Fjord samples: Soft mud was collected using a Waren dredge at 53 m depth in the Gullmarn Fjord near Lysekil, Lysekil municipality, Västra Götalands county (N 58°15.73', E 11°26.10').

Meiofaunal extraction

Hållö island. Hållö island samples were extracted in the lab using two different variations of the flotation (decanting and sieving) technique.

Flotation (freshwater): Freshwater was used to induce an osmotic shock in meiofaunal organisms and force them to detach from heavy sediment particles. 200 mL of sediment were placed in a large volume of fresh water and thoroughly mixed to suspend meiofauna and lighter sediment particles. The supernatant was sieved through a 1000 µm sieve to separate the macrofaunal fraction, which was then discarded. The filtered sample was sieved again through a 45 µm sieve to collect meiofauna and discard fine organic particles. This procedure was repeated three times. Meiofauna was then rinsed with seawater from the sieve into large falcon tubes. Twelve sediment samples were processed, ten of them were fixed immediately in 96% ethanol for molecular analysis and stored at -20°C. The other two samples were first screened for live representatives of Xenacoelomorpha, and later preserved in 4% formaldehyde for morphology-based identification of nematodes.

Flotation (MgCl2 solution): A 7.2% solution of MgCl2 was used to anesthetize meiofauna. As above, twelve samples were processed in total, ten of them were decanted through 125 µm sieve and fixed immediately in 96% ethanol for molecular analysis and stored at -20°C, while two samples were decanted through a 125 µm sieve which was subsequently placed in a petri dish with seawater. After 30 minutes, the petri dish as well as the inside of the sieve were searched for Xenacoelomorpha using a stereo microscope. Afterwards they were preserved in 4% formaldehyde for morphology-based identification of nematodes.

Gullmarn Fjord. Meiofauna was extracted from the Gullmarn Fjord samples using two different methods: flotation and siphoning.

Flotation (freshwater): Freshwater was used to induce an osmotic shock in meiofaunal organisms. 2.4 L of sediment were placed in a large volume of freshwater, thoroughly mixed to suspend meiofauna and lighter sediment particles. The supernatant was sieved through a 1000 µm sieve in order to separate macrofauna, which was then discarded. The filtered sample was then sieved three times through a 70µm sieve to collect meiofauna and discard fine organic particles. Meiofauna was then rinsed with seawater from the sieve into a large container and equally divided between 12 falcon tubes. Six samples were fixed in 96% ethanol for molecular analysis and stored at -20°C. Six samples were screened for live representatives of Xenacoelomorpha, and preserved in 4% formaldehyde for morphology-based identification of nematodes.

Siphoning: A total volume of 12 L of sediment was processed as follows: an approximately 5 cm thick layer of mud was placed in a container and covered with 20 cm of seawater.  The sediment was allowed to settle for 20 hours. Half of the sediment area was then siphoned through a 125 µm sieve, the residue in the sieve was immediately fixed in 96% ethanol, large macrofauna was manually removed, and the entire volume was split equally into six samples and placed at -20°C for subsequent molecular analysis. The remaining half of the area was similarly siphoned through a 125 µm sieve, the sieve contents were stored in sea water, large macrofauna manually removed, the entire volume split into six samples, which were screened for live representatives of Xenacoelomorpha, and preserved in 4% formaldehyde for morphology-based identification of nematodes.

Morphology-based identification

Xenacoelomorpha. Four samples from Hållö and 12 samples from Gullmarn Fjord were used for morphology-based assessment of the diversity of Xenacoelomorpha. All samples were stored in seawater and searched for Xenacoelomorpha with a stereo microscope. All specimens found were immediately identified to the lowest taxonomic rank possible using a compound microscope equipped with DIC.

Nematoda. Two samples from each location/extraction method were used to assess nematode diversity using morphology-based identification. Samples from Hållö (flotation with fresh water and MgCl2) and Gullmarn Fjord (siphoning) were processed whole and samples from Gullmarn Fjord extracted using flotation with fresh water were subsampled by taking 1/10 of the entire sample. Formaldehyde–preserved samples were transferred to glycerin using Seinhorst’s rapid method as modified by De Grisse (1969). Permanent nematode mounts on glass slides were prepared using the paraffin wax ring method. It is common practice to estimate the diversity of marine nematodes by counting a predetermined number (usually 100 or 200) of randomly picked nematodes per sample (Vincx 1996), which may not provide sufficiently detailed results for samples with high diversity. Therefore, all nematode specimens were counted and identified for each analyzed sample. All nematode specimens were identified to genus, and, when possible, to species level.

DNA extraction, library preparation and sequencing

DNA extraction. 30 samples were processed for total DNA extraction, twelve from the Gullmarn Fjord and eighteen from Hållö island, using 10g of sediment and the PowerMax® Soil DNA Isolation Kit (MO BIO Laboratories), according to manufacturer’s instructions.

Primer design. Illumina MiSeq reagent v3. produces paired-end reads of 300bp in length, allowing a maximum marker length of 500bp when taking into account a 50 bp overlap. Universal COI primers available for the Metazoa amplify a 658bp region (Folmer et al. 1994), which is too long for most NGS applications.

Accordingly, primers amplifiying a 313 bp fragment of the mitochondrial cytochrome oxidase 1 (COI) gene were used, as described in Bourlat et al. 2016. The primers used for COI are modified from Leray et al.’s ‘mini-barcode’ COI primers (mlCOIintF-dgHCO2198; Leray et al. 2013) by adding the Illumina MiSeq overhang adapter sequences. The Leray et al. ‘mini-barcode’ primers have been shown to amplify up to 91% of metazoan diversity in a sample (Leray et al. 2013). In combination with Leray et al.'s mini barcode forward primer (mlCOIintF), we used Folmer et al.'s COI reverse primer (dgHCO2198; Folmer et al. 1994) as well as a reverse primer developed by Lobo et al., shown to enhance amplification of the COI region in a wide range of invertebrates (Lobo et al. 2013).

For the 18S region, Illumina overhang adapter sequences were appended to the primers from Fonseca et al. (SSU_FO4-SSU_R22; Fonseca et al. 2010), yielding a 364 bp fragment. These primers target a homologous region of the gene and flank a region that is highly divergent, corresponding to the V1-V2 region of the 18S gene (Lindeque et al. 2013, Fonseca et al. 2010).

Sequence overlap in the paired-end reads was calculated in Geneious Kearse et al. 2012. COI shows a sequence overlap of 230 bp and 18S shows an overlap of 190 bp.

All primer sequences used are shown in Table 2.

Primer sequences used in this study

Marker

Primer name

Illumina adapter overhang (regular font), with primer sequence (in bold)

COI Leray

mlCOIintF

5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGWACWGGWTGAACW GTWTAYCCYCC-3’

dgHCO2198

5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAAACTTCAGGGTGAC CAAARAAYCA-3’

COI Lobo

mlCOIintF

5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGWACWGGWTGAACW GTWTAYCCYCC-3’

LoboR1

5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAAACYTCWGGRTGW CCRAARAAYCA-3’

18S

SSU_FO4

5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCTTGTCTCAAAGATTA AGCC-3’

SSU_R22

5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCTGCTGCCTTCCTT GGA-3’

Illumina MiSeq library preparation using fusion primers. For Illumina MiSeq library preparation, we used a dual PCR amplification method as described in Bourlat et al. (2016). The first PCR, the amplicon PCR, uses amplicon specific primers including the Illumina adapter overhang, as described above. The second PCR, the index PCR, allows the incorporation of Illumina index adapters using a limited number of cycles (Bourlat et al. 2016).

Amplicon PCR. PCR amplifications of the COI and 18S regions were set up as follows. For a 50µl reaction volume, we used 5µl Pfu polymerase buffer (10x), 1µl dNTP mix (final concentration of each dNTP 200µM), 0.5 µl of each primer at 50 pm/µl, 2 µl DNA template (~10 ng), 0.5µl Pfu DNA polymerase (Promega) and 40.5µl of nuclease free water. Each DNA sample was amplified with the 3 primer pairs described above (COI Leray, COI Lobo and 18S). PCR cycling conditions were 2 min at 95°C (1 cycle); 1 min at 95°C, 45 s at 57°C, 2 min at 72°C (35 cycles); 10 min at 72°C (1 cycle). The PCR was checked on a 2% agarose gel. 20µl of each PCR reaction were then purified with Agencourt® AMPure® XP paramagnetic beads (Beckman Coulter), allowing size selection of PCR fragments by using different PCR product to bead ratios (Bourlat et al. 2016).

Index PCR. For dual indexing we used the Nextera XT index kit (96 indices, 384 samples, Illumina) according manufacturers’ instructions. Dual indexing allows an increase in the multiplex level of sequencing per lane, so that more samples can be sequenced on the same flow cell (Fadrosh et al. 2014). It also eliminates cross-contamination between samples and the occurrence of mixed clusters on the flow cell (Kircher et al. 2012). The index PCR was set up as 50µl reactions using 5µl of cleaned up PCR amplicons, 5µl of Nextera XT Index Primer i5, 5µl of Nextera XT Index Primer i7, 25µl of 2x KAPA HiFi HotStart ready mix (Kapa Biosystems) and 10µl of nuclease free water. PCR cycling conditions were: 3 min at 95°C (1 cycle); 30 s at 95°C, 30 s at 55°C, 30 s at 72°C (8 cycles); 5 min at 72°C (1 cycle). A bead purification was carried out after the index PCR with Agencourt® AMPure® XP magnetic beads (Beckman Coulter) using a ratio of 0.8, allowing the selection of fragments larger than 200 bp. DNA was quantified before sequencing using a Qubit Fluoremeter (Invitrogen) and average fragment size was verified using Tapestation (Agilent Technologies). Further library normalization and pooling steps are described in Bourlat et al. (2016).

Sequencing. The pooled libraries were sequenced three times independently using Illumina MiSeq Reagent Kit v3, producing in total 24 132 875 paired-end reads of 300 bp in length, of which 15 883 274 COI reads and 8 249 601 18S reads (Table 3).

Number of reads per marker and per sequencing run

Marker / Sequencing run

1

2

3

Total

COI

5 859 454

5 075 735

4 948 085

15 883 274

18S

2 803 391

3 135 331

2 310 879

8 249 601

Total

8 662 845

8 211 066

7 258 964

24 132 875

Bioinformatic data processing and analysis

Most analytical steps were performed using Qiime (Quantitative Insight Into Microbial Ecology) version 1.9.1 (Caporaso et al. 2010) and custom python scripts (Fig. 1).

Figure 1.  

Schematic workflow of bioinformatic analytical steps

Paired-end joining

Demultiplexed MiSeq paired-end reads were joined using the Qiime script multiple_join_paired_ends.py using the fastq-join tool (https://code.google.com/p/ea-utils/wiki/FastqJoin). Data from three sequencing runs were merged producing a total of 24 132 875 raw paired-end reads, 15 883 274 reads for the COI dataset and 8 249 601 reads for the 18S dataset (Table 3). The number of reads remaining after various bioinformatic data processing steps is presented in Table 4. After paired-end joining, 48% of sequences were lost leading to a total of 12 543 198 reads, due to an observed decrease in sequence quality at the end of the reads, resulting in a bad overlap between the paired-ends. This loss is much more important for the longer 18S region (2 131 102 reads after joining, corresponding to a 74% loss) than for the COI region (10 412 096 reads after joining, corresponding to a 34,5% loss).

Number of reads remaining after each bioinformatic step

Marker / Step

Raw data

Paired-end joining

Primer trimming

Quality filtering

Chimera removal

COI

15 883 274

10 412 096

8 099 507

7 976 649

7 954 017

18S

8 249 601

2 131 102

1 071 871

1 015 874

890 370

Total

24 132 875

12 543 198

9 171 378

8 992 523

8 844 387

Primer trimming and quality filtering

Dual indexes and Illumina overhangs were removed by the sequencing platform. COI and 18s primer sequences were removed using a custom python script designed for this study (https://github.com/Quiterie90/Primer_Removal). The script retains and trims reads that have the exact sequence of the forward and reverse primers at the beginning and at the end of the reads respectively, while other reads not meeting these criteria are discarded. The script takes into account the presence of ambiguous bases in the primer sequence (such as W, R, S, Y, M, K, H, D, B and V). In the case that an unassigned base (N) is found in the primer sequence, the read is also discarded. The primer-trimming step resulted in 9 171 378 reads remaining corresponding to a 27% loss. As the script is quite stringent, it quality filters reads by removing incomplete reads or chimeras. At this step 1 071 871 reads remained after trimming for the 18S dataset corresponding to a 50% loss and 8 099 507 reads remained after trimming for the COI dataset corresponding to a 22% loss. A quality filtering step was then carried out using the Qiime script multiple_split_ libraries_fastq.py to remove reads with a Q Score inferior to 30 (corresponding to a base call accuracy of at least 99,9%). A total of 2% of sequences were lost after the quality-filtering step leading to 8 992 523 reads remaining. 5% of the reads were lost in the 18S dataset corresponding to a final 1 015 874 reads and 1,5% of the reads were lost in the COI dataset corresponding to a final 7 976 649 reads.

Chimera removal and OTU clustering

Chimeric reads were removed with UCHIME (Edgar et al. 2011) using the Qiime scripts identify_chimeric_seqs.py followed by filter_fasta.py based on the Usearch61 software. After chimera removal, 7 954 017 sequences remained in the COI dataset (0,3 % loss) and 890 370 sequences remained in the 18S dataset (12% loss).

For clustering sequences into Operational Taxonomic Units (OTUs) we used CROP, a Bayesian clustering algorithm that delineates OTUs based on the natural distribution of the data, using a Gaussian mixture model (Hao et al. 2011). The program allows the user to define a lower and upper bound variance to cluster the sequences, instead of a fixed sequence similarity value. According to a benchmarking study by Leray et al. based on the Moorea Biocode barcode library (http://mooreabiocode.org/Leray et al. 2013), the best lower and upper bound values to cluster metazoan COI sequences are 3 and 4, corresponding to sequence dissimilarities between 6% and 8%. According to an 18S benchmarking experiment with a set of 41 known nematode species carried out by Porazinska et al., a 96% threshold most accurately reflects taxonomic richness, yielding 37 OCTUs, whereas a 97% threshold yielded 51 OCTUs (Porazinska et al. 2009). According to this benchmark, a range of sequence dissimilarities between 3% and 5% were used in CROP (1.5 and 2.5 respectively for the lower and upper values, corresponding to 95-97% similarity).

Parameters used in CROP for the analysis were as follows:

CROP -i <input_CO1.fasta>  -b 160 000 -z 470 -l 3 -u 4 -o <output_CO1>

CROP -i <input_18S.fasta>  -b 18 000 -z 470 -l 1.5-u 2.5 -o <output_18S

The 7 954 017 COI sequences and the 890 370 18S sequences were clustered into 2805 and 1472 representative OTUs respectively, 213 of which were identified to species for COI and 243 of which were identified to species for 18S, using a 97% sequence similarity threshold (Table 5 Fig. 2).

Number of OTUs and percentage per phylum for COI and 18S for the metazoan fraction. Based on a 97% similarity threshold.

Phylum

COI

18S

 

OTUs

Percentage

OTUs

Percentage

Annelida

57

30.00

29

23.97

Arthropoda

52

27.37

14

11.57

Bryozoa

5

2.63

3

2.48

Cephalorhyncha

0

0.00

1

0.83

Chaetognatha

1

0.53

0

0.00

Chordata

12

6.32

7

5.79

Cnidaria

8

4.21

4

3.31

Echinodermata

13

6.84

5

4.13

Gastrotricha

1

0.53

9

7.44

Gnathostomulida

1

0.53

0

0.00

Mollusca

26

13.68

6

4.96

Nematoda

0

0.00

10

8.26

Nemertea

3

1.58

6

4.96

Platyhelminthes

0

0.00

13

10.74

Phoronida

1

0.53

0

0.00

Porifera

2

1.05

3

2.48

Priapulida

1

0.53

0

0.00

Rotifera

2

1.05

0

0.00

Sipuncula

1

0.53

1

0.83

Tardigrada

0

0.00

1

0.83

Xenacoelomorpha

4

2.11

9

7.44

Total OTUs Metazoa

190

100

121

100

Figure 2.  

Taxonomic composition overview at species level based on a 97% sequence similarity threshold. A) Percentages and counts of OTUs for the COI gene with unassigned OTUs. B) Percentages and counts of OTUs for the COI gene without unassigned OTUs. C) Percentages and counts of OTUs for the 18S gene with unassigned OTUs. D) Percentages and counts of OTUs for the 18S gene without unassigned OTUs.

Figure 3.  

Percentages of metazoan phyla uncovered in the samples using COI and 18S molecular surveys. Blue bars correspond to the cumulated frequencies of OTUs assigned to a specific phylum using the COI gene and red bars correspond to the cumulated frequencies of OTUs assigned to a specific phylum using the 18S gene. Taxonomic assignment is based on a 97% sequence similarity threshold.

Taxonomic assignment

As Qiime is normally used for metagenomic analyses of prokaryotes, default databases are not suited for taxonomic assignment of Metazoa. Custom databases consisting in a taxonomy file associated with a reference sequence file can be created, or alternatively, a preformatted database such as the Silva database (http://www.arb-silva.de/no_cache/download/archive/qiime/) can be used. For the COI region, a custom database of 1 947 954 sequences was created consisting of the BOLD database (http://www.boldsystems.org/ downloaded on October 8 2015), combined with own reference databases of Nemertea, Xenacoelomorpha and Oligochaeta and barcodes of Swedish Echinodermata, Mollusca, Cnidaria and Arthropoda from the Swedish Barcode of Life database (SweBol). For the 18S rRNA region, a custom database of 732 419 reference sequences was created using the Silva database release 111 (http://www.arb-silva.de/no_cache/download/archive/qiime/) and own barcodes for Acoela and Oligochaeta. Corresponding tab-delimited taxonomy files were created including a sequence ID and taxonomic lineage information (Phylum, Class, Order, Family, Genus and Species) derived from BOLD, Swebol, Silva and WoRMS (http://www.marinespecies.org/).

Taxonomic assignments were carried out using both 80% and 97% sequence similarity thresholds, to obtain identifications at phylum and species levels respectively (Giongo et al. 2010, Lanzén et al. 2012), yielding 690 metazoan OTUs for COI and 793 metazoan OTUs for 18S at 80% threshold and 190 metazoan OTUs for COI and 121 metazoan OTUs for 18S at 97% threshold. For COI, taxonomic assignment was done with the Qiime script assign_taxonomy.py using the Uclust software (Edgar 2010). With Uclust, a query sequence matches a database sequence if the identity is high enough. The identity is calculated from a global alignment, which differs from BLAST and most other database search programs, which search for local matches. By default, Uclust stops searching when it finds a match, but also stops searching if it fails to find a match after eight failed attempts. Within Qiime, Uclust is the default algorithm for the assign_taxonomy.py script and two parameters are associated to the algorithm. The minimum fraction of database hits that must have a specific taxonomic assignment to assign that taxonomy to a query that was fixed at 0.51 and the number of database hits to consider when making an assignment that was fixed at 3, corresponding to the default values. To obtain matches for non-Metazoan taxa, a Megablast search with 70% minimum coverage was done against the Genbank nt (nucleotide) database (ftp://ftp.ncbi.nlm.nih.gov/blast/db/ downloaded on June 27 2015) using Geneious (Kearse et al. 2012). For taxonomic assignment of the 18S dataset, the Qiime script assign_taxonomy.py was used with Uclust (Edgar 2010) default settings against the Silva database. Some taxonomic errors were detected for Nematodes in the Silva database.

Note on the taxonomic assignement of Nematodes: The output from the Qiime analysis included 145 18S OTUs assigned to the phylum Nematoda. Three of them (HE1.SSU866120, HE6.SSU382930 and HF6.SSU331569) Suppl. material 1 were incorrectly placed among the nematodes due to errors in the reference database they derived from – they group among Arthropod taxa by the Megablast search and were excluded for that reason. Another OTU (TS6.SSU559982) is placed among Phoronida by the Megablast search and was also excluded. Two more sequences that were assigned to Nematoda appear to have long insertions within conserved regions (HE6.SSU358113 and TF5.SSU411806). Both of them were found only in one sample each, further supporting the idea that they are derived from erroneous amplification product, and were removed from any further analysis.

Invasive Alien Species (IAS) were detected in our samples by comparing our species list (Suppl. material 1) to the Helcom-Ospar list (http://www.helcom.fi/about-us/partners/ospar) and the Swedish Främmande Arter invasive species lists (http://www.frammandearter.se/).

Taxonomic composition bar plots (Fig. 4) were created using OTU tables (Suppl. materials 2, 3) and the Qiime scripts make_otu_table.py, split_otu_table_by_taxonomy, merge_otu_table.py and summarize_taxa_through_plots.py. The bar plots created for Fig. 4 take into account the relative abundance or number of reads for each OTU, whereas Table 5 and Fig. 3 do not take relative abundances of each OTU into account. Fig. 3 showing community composition per phylum and marker was created using PhyloT (http://phylot.biobyte.de/) and Evolview tools (http://www.evolgenius.info/evolview.html; (Zhang et al. 2012).

Figure 4.  

Community composition per phylum in Hållö island and Gullmarn fjord samples, according to extraction method (MgCl2, H2O, Siphoning). A) For the COI gene. B) For the 18S gene. The vertical axis corresponds to percentage of OTUs. Taxonomic assignment is based on a 97% similarity threshold. The bar plots take into account number of reads for each OTU.

Diversity analyses

Alpha and beta diversity analyses were carried out with and without unassigned OTUs for both COI and 18S datasets. Unassigned OTUs were removed using the Qiime script filter_otus_from_otu_table.py. Alpha diversity (species richness) was calculated using the nonparametric Chao1 index using rarefied datasets to correct bias in species number due to unequal sample size. One of the samples in the COI dataset was removed prior to rarefaction analysis due to low sequence number (1122 sequences including unassigned OTUs and 280 sequences excluding unassigned OTUs at 97% sequence similarity) using the Qiime script filter_sample_from_otu_table.py. Rarefaction, alpha diversity calculation and generation of plots were performed using the Qiime scripts i) multiple_rarefactions.py, ii) alpha_diversity.py, iii) collate_alpha.py and iv) make_rarefaction_plots.py. Rarefaction was done to a depth corresponding to the total number of sequences in the smallest dataset (20405 sequences including unassigned OTUs and 5442 sequences excluding unassigned OTUs at 97% sequence similarity for COI, and 7561 sequences including unassigned OTUs and 5399 sequences excluding unassigned OTUs at 97% sequence similarity for 18S). Alpha diversities were compared between locations and extraction methods for both datasets and COI primer sets using the Qiime script compare_alpha_diversity.py. The script performs Monte-Carlo permutations to determine p-values.

Beta diversity was calculated using the abundance-based Bray-Curtis index for both COI and 18S datasets. The Qiime script beta_diversity_through_plots.py was used to compute beta diversity distance matrices from the rarefied samples and generate Principal Coordinate Analysis (PCoA) plots. Beta diversity was compared according to location, extraction method and primer pair both with and without the unassigned OTUs using the Qiime script compare_categories.py. The script uses R and the vegan and ape libraries to compute statistical tests. We performed ANOSIM (ANalysis Of SIMilarity) tests, which are nonparametric, through 999 permutations. This method tests whether two or more groups of samples are significantly different by taking as null hypothesis that there is no difference between the two or more groups studied.

Alpha and beta diversities were calculated including and excluding the unassigned OTUs and results obtained were similar. Here we present plots including the unassigned OTUs (Figs 5, 6).

Figure 5.  

Alpha diversity rarefaction plots for COI and 18S datasets including unassigned OTUs. According to location for COI (A) 18S (B). Hållö Island (HI) in red, Gullmarn Fjord (GF) in blue. According to extraction method for COI (C) 18S (D). HI flotation in red, HI MgCl2 in blue, GF flotation in yellow, GF siphoning in green. According to primer pair for COI (E). CO1 Leray primer in red, COI Lobo primer in blue.

Figure 6.  

Beta diversity PCoA plots for COI and 18S datasets including unassigned OTUs. According to extraction method for COI (A) 18S (B) HI flotation in red, HI MgCl2 in blue, GF flotation in yellow and GF siphoning in green. According to primer for COI (C) COI Leray primer in red, COI Lobo primer in blue

Data resources

The data underpinning the analysis reported in this paper are deposited at the GenBank SRA under project number PRJNA388326 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA388326).

Results and discussion

Phylum-level community composition of meiofaunal samples from the Swedish west coast

Illumina MiSeq produced at total of 24 132 875 raw reads, of which 15 883 274 COI reads and 8 249 601 18S reads. These were quality filtered (see methods section for details) resulting in 7 954 017 COI sequences and 890 370 18S sequences. These were clustered into 2805 and 1472 representative OTUs respectively, yielding 190 metazoan OTUs for COI and 121 metazoan OTUs for 18S at 97% sequence similarity (see methods, Table 5 & Fig. 2).

Taxonomic assignment of OTUs at a 97% similarity threshold shows community composition of the samples at the phylum level (Fig. 2). Of 2805 COI OTUs, 190 (7%) were assigned to the Metazoa, 22 (1%) to plants and algae, 1 (0%) to Fungi. 2592 OTUs remained unassigned, corresponding to 92% of COI OTUs.

For the 18S dataset, 121 of 1472 OTUs (8%) were assigned to Metazoa, 104 (7%) to plants and algae, 10 (1%) to Fungi, and 8 (1%) to Protozoa. 1229 OTUs remained unassigned, corresponding to 83% of all 18S OTUs.

The large numbers of unassigned OTUs reflect the incompleteness of the databases used for COI and 18S. When unassigned OTUs are disregarded, differences between the taxonomic ocverage of the markers can be observed (Fig. 2, B and D). COI is the ‘standard’ animal barcode and is thus mostly useful for diversity surveys within the Metazoa (Hebert et al. 2003). 18S has on the other hand much larger taxonomic coverage and can be used for biodiversity profiles of whole eukaryotic communities, at higher taxonomic scales.

Of all OTUs classified as Metazoa, a detailed breakdown per phylum is presented in Table 5 and Fig. 3. Annelida (30% of CO1 metazoan OTUs and 23.97% of 18S metazoan OTUs) and Arthropoda (27.37% of CO1 metazoan OTUs and 11.57% of 18S metazoan OTUs), were the most OTU rich phyla identified in all samples combined, a similar pattern as observed in a recent study on coastal seagrass meadows in Brittany, France (Cowart et al. 2015).

As well as Annelida and Arthropoda, other phyla represented by a high number of OTUs in our samples include Mollusca (13.68% of COI metazoan OTUs and 4.96% of 18S metazoan OTUs), Platyhelminthes (10,74% of 18S metazoan OTUs and 0% of CO1 metazoan OTUs) and Nematoda (8.26% of 18S metazoan OTUs and 0% of CO1 metazoan OTUs) (Table 5 & Fig. 3). Other benthic metabarcoding studies based on the 18S V1-V2 region, found Nematoda and Platyhelminthes as the most OTU rich phyla represented (Fonseca et al. 2014, Fonseca et al. 2010), or Nematoda and Annelida (Bik et al. 2012b), alternatively Nematoda and Arthropoda (Bik et al. 2012a, Lallias et al. 2015).

Meiofaunal community composition differs according to location

Taxonomic community composition at both locations surveyed is illustrated in Fig. 4. The bar plots in Fig. 4 take into account the read counts for each OTU, whereas Table 5 and Fig. 3 do not take these into account.

In Fig. 4, clear differentiation in biodiversity between the two habitat types (soft mud versus coarse shell sand) can be observed, as expected. Echinodermata (such as Ophiurida, Echinoidea and Asteroidea), Mollusca (Bivalvia, Gastropoda), Annelida and Arthropoda are represented by higher numbers of reads in samples from the muddy sediments in the Gullmarn fjord samples (grain size 100 μm approx.).

In coarse shell sand in shallow areas, such as in the Hållö island samples, Annelida and Arthropoda are represented by higher numbers of reads, followed by Chordata (cephalohordata such as Branchiostoma sp., ascidians and various fish species such as Gobius sp., Ctenolabrus rupestris, Solea solea) with in addition a larger diversity of small taxa such as Bryozoa, Gnathosthomulida, Gastrotricha, Tardigrada, Rotifera, Sipuncula and Phoronida, reflecting the high diversity of insterstitial taxa found in sandy sediments.

Sample diversity and composition analyses

A greater number of phyla were uncovered in the Hållö Island samples than in the Gullmarn Fjord samples (Fig. 4A and 4B) and this observation was corroborated by the alpha diversity rarefaction plots showing that Hållö Island samples (in red) present a higher diversity than the Gullmarn Fjord samples (in blue) (p-value = 0.001) regardless of the marker used (Fig. 5A and 5B). Within the same location, choice of extraction method does not have a significant impact on sample diversity (p-value ~ 1) (Fig. 5C and 5D, Table 6). However, for the 18S dataset, the flotation method seems to be more effective for extraction of nematodes than the siphoning method in the Gullmarn Fjord samples (Fig. 4A and 4B). Moreover, the beta diversity PCoA results highlight the fact that sample composition is influenced by the choice of extraction method for both COI and 18S datasets (p-value = 0.001) leading to four different clusters (Fig. 6and 6B, Table 6). For the COI dataset, in addition to extraction method as a factor of divergence, choice of primer (COI Leray or COI Lobo) also influences the grouping of the samples (p-value = 0.003 excluding unassigned OTUs and 0.001 including unassigned OTUs), in particular for the Hållö Island samples (Fig. 6C). Moreover, the COI Lobo primer seems to uncover a higher diversity of taxa than the COI Leray primer Fig. 5E) even if the results are considered to be non significant (p-value = 0.585 excluding unassigned OTUs and 0.111 including unassigned OTUs) (Table 6, Table 7).

Nonparametric t-test results with 999 Monte-Carlo permutations for both datasets with and without unassigned OTUs (97% taxonomic assignment)

 

COI dataset

18S dataset

 

Excluding unassigned OTUs

Including Unassigned OTUs

Excluding unassigned OTUs

Including Unassigned OTUs

 

Test value

P-value

Test value

P-value

Test value

P-value

Test value

P-value

Location

 

 

 

 

 

 

 

 

HI vs. GF

-14.453

0.001

-21.455

0.001

-6.929

0.001

-7.170

0.001

Method

 

 

 

 

 

 

 

 

HI H2O vs. HI MgCl2

-0.437

1.0

-0.691

1.0

-0.906

1.0

-0.174

1.0

GF flotation vs. GF siphoning

1.567

0.792

1.546

0.99

-1.427

1.0

-0.744

1.0

Primer

 

 

 

 

 

 

 

 

COI Leray vs. COI Lobo

-0.508

0.596

-1.614

0.111

-

-

-

-

ANOSIM test results (999 permutations) for both COI and 18S datasets with and without unassigned OTUs (97% taxonomic assignment)

 

COI dataset

18S dataset

Ho: Sample composition differs according to

Excluding unassigned OTUs

Including unassigned OTUs

Excluding unassigned OTUs

Including unassigned OTUs

 

R-value

P-value

R-value

P-value

R-value

P-value

R-value

P-value

Location

0.976

0.001

1.0

0.001

0.935

0.001

0.929

0.001

Method

0.660

0.001

0.738

0.001

0.889

0.001

0.895

0.001

Primer

0.200

0.003

0.218

0.001

-

-

-

-

Molecular identifications to species level

Using a sequence similarity search at 97% similarity allowed us to identify 213 COI OTUs and 243 18S OTUs to species level (Table 8 and Suppl. material 1). For the COI dataset, 81 species (of which 70 metazoans) were found in both locations, 36 (of which 35  metazoans) were found in the Gullmarn fjord only and 96 (of which 85 metazoans) were found in Hållö island only. For the 18S dataset, 108 species (of which 48 metazoans) were found in both locations, 44 (of which 21 metazoans) were found in the Gullmarn fjord only and 91 (of which 52 metazoans) were found in Hållö Island only (Suppl. material 1). These species observations from metabarcoding represent 'molecular occurrence records' that could be used in monitoring and other types of biodiversity surveys, in the same way as physical observations, such as for mapping species distributions (Bohmann et al. 2014, Lawson Handley 2015).

Metazoa identified to species level using 97% sequence similarity (HI: Hållö island, GF: Gullmarn Fjord)

COI
OTU ID Nb of reads Phylum Class Order Species HI GF
HE6.Lobo_7972794 3 Annelida Clitellata Haplotaxida Adelodrilus pusillus + -
HE1.Lobo_933012 14954 Annelida Clitellata Haplotaxida Grania postclitellochaeta + +
HF8.Lobo_5239705 241 Annelida Clitellata Haplotaxida Grania variochaeta + +
HF4.Lobo_97092 29391 Annelida Clitellata Haplotaxida Tubificoides benedii + +
HF5.Lobo_3297996 1 Annelida Clitellata Haplotaxida Tubificoides kozloffi + -
TS1.Leray_545620 7370 Annelida Polychaeta Amphinomida Paramphinome jeffreysii - +
HF1.Lobo_4996219 4596 Annelida Polychaeta Canalipalpata Polygordius appendiculatus + +
TF6.Lobo_5247622 9030 Annelida Polychaeta Capitellida   - +
TS1.Lobo_4669404 5 Annelida Polychaeta Capitellida   - +
TF5.Lobo_6394093 2 Annelida Polychaeta Capitellida   - +
TS3.Leray_6813257 1852 Annelida Polychaeta Eunicida   - +
HF5.Leray_4035802 1 Annelida Polychaeta Eunicida Ophryotrocha maculata + -
TS2.Leray_4445240 8815 Annelida Polychaeta Eunicida Parougia eliasoni + +
TF3.Leray_6645504 5196 Annelida Polychaeta Opheliida   + +
TS5.Lobo_6031643 5089 Annelida Polychaeta Opheliida   + +
HF9.Lobo_7587930 1 Annelida Polychaeta Opheliida   + -
HE8.Leray_7284535 2 Annelida Polychaeta Phyllodocida   + -
TS5.Leray_1557252 88 Annelida Polychaeta Phyllodocida   - +
TS3.Leray_6744085 1 Annelida Polychaeta Phyllodocida   - +
TS3.Leray_6805306 2 Annelida Polychaeta Phyllodocida Aphrodita aculeata - +
TS3.Lobo_1308935 4213 Annelida Polychaeta Phyllodocida Eumida ockelmanni + +
HE6.Leray_2958692 69642 Annelida Polychaeta Phyllodocida Glycera alba + +
HF7.Leray_1672792 69 Annelida Polychaeta Phyllodocida Glycinde nordmanni + +
TF5.Leray_2872180 7754 Annelida Polychaeta Phyllodocida Gyptis mackiei - +
HF1.Lobo_5059232 13 Annelida Polychaeta Phyllodocida Gyptis propinqua + -
HF9.Lobo_7695035 1 Annelida Polychaeta Phyllodocida Lepidonotus squamatus + -
HE6.Lobo_7972042 2 Annelida Polychaeta Phyllodocida Myrianida edwarsi + -
HF9.Lobo_7688887 3 Annelida Polychaeta Phyllodocida Nereimyra punctata + -
HF2.Lobo_2136301 178929 Annelida Polychaeta Phyllodocida Pisione remota + +
HE3.Leray_364663 59407 Annelida Polychaeta Phyllodocida Platynereis dumerilli + +
TS4.Leray_7471107 1 Annelida Polychaeta Phyllodocida Sige fusigera - +
HE5.Lobo_493462 571790 Annelida Polychaeta     + +
TS2.Lobo_6962270 4595 Annelida Polychaeta Sabellida Galathowenia oculata + +
TS2.Leray_4491798 316559 Annelida Polychaeta Spionida   + +
TS4.Lobo_1502925 195999 Annelida Polychaeta Spionida   + +
HF9.Lobo_7588557 891 Annelida Polychaeta Spionida   + -
TS6.Leray_5665274 936 Annelida Polychaeta Spionida   - +
TF1.Lobo_2668551 874 Annelida Polychaeta Spionida   - +
HE4.Leray_3067470 3 Annelida Polychaeta Spionida Chaetopterus sarsi + -
HF1.Lobo_4965916 1 Annelida Polychaeta Spionida Malacoceros fuliginosus + -
HF9.Leray_4404528 1 Annelida Polychaeta Spionida Polydora cornuta + -
HF5.Lobo_3178682 2894 Annelida Polychaeta Spionida Spiophanes bombyx + +
TF1.Leray_2314881 29235 Annelida Polychaeta Terebellida   + +
TF1.Lobo_2832834 9348 Annelida Polychaeta Terebellida   + +
TS1.Leray_614419 788 Annelida Polychaeta Terebellida   + +
HE8.Lobo_858951 1 Annelida Polychaeta Terebellida   + -
TS2.Lobo_6889557 184 Annelida Polychaeta Terebellida   - +
TS6.Lobo_255019 3 Annelida Polychaeta Terebellida   - +
TS2.Lobo_6860909 1 Annelida Polychaeta Terebellida   - +
TS5.Leray_1638640 1 Annelida Polychaeta Terebellida   - +
TF1.Lobo_2848745 1305 Annelida Polychaeta Terebellida Amphictene auricoma + +
TS3.Leray_6729893 1 Annelida Polychaeta Terebellida Brada villosa - +
HF4.Lobo_96799 102 Annelida Polychaeta Terebellida Cirratulus cirratus + -
HF2.Lobo_2052205 285 Annelida Polychaeta Terebellida Dodecaceria concharum + -
TS5.Leray_1638834 102 Annelida Polychaeta Terebellida Lagis koreni + +
HE9.Lobo_2191024 8 Annelida Polychaeta Terebellida Macrochaeta clavicornis + +
TF1.Leray_2475372 6353 Annelida Polychaeta Terebellida Sosane wahrbergi + +
HE1.Lobo_982378 38 Arthropoda Branchiopoda Diplostraca Evadne nordmanni + -
TF5.Lobo_6391642 10097 Arthropoda Branchiopoda Diplostraca Penilia avirostris + +
HF9.Lobo_7623741 1 Arthropoda Branchiopoda Diplostraca Pleopis polyphemoides + -
TS4.Leray_7402581 10 Arthropoda Insecta Diptera   + +
TS3.Lobo_1162454 2 Arthropoda Insecta Diptera Chironomus aprilinus + +
HF4.Lobo_5006 1 Arthropoda Insecta Diptera Cryptochironomus supplicans + -
TF5.Leray_2910679 6 Arthropoda Insecta Diptera Procladius sp. + +
HF9.Lobo_7599310 3 Arthropoda Insecta Diptera Psectrocladius yunoquartus + +
HE5.Lobo_479906 152 Arthropoda Insecta Diptera Tanytarsus usmaensis + +
HE2.Lobo_2023271 21589 Arthropoda Malacostraca Amphipoda   + +
HF1.Leray_2493444 3911 Arthropoda Malacostraca Amphipoda   + -
HE8.Lobo_860608 1 Arthropoda Malacostraca Amphipoda   + -
HE3.Lobo_4900763 1 Arthropoda Malacostraca Amphipoda Ampelisca brevicornis + -
HF4.Leray_6193380 66039 Arthropoda Malacostraca Amphipoda Atylus vedlomensis + +
HE8.Leray_7216397 1 Arthropoda Malacostraca Amphipoda Corophium volutator + -
HE6.Lobo_7849183 1 Arthropoda Malacostraca Amphipoda Leptocheirus hirsutimanus + -
HE1.Lobo_914374 14588 Arthropoda Malacostraca Amphipoda Monocorophium insidiosum + +
TF1.Leray_2445583 56 Arthropoda Malacostraca Amphipoda Monoculodes packardi - +
TF6.Leray_5321299 11588 Arthropoda Malacostraca Cumacea   + +
HF9.Leray_4291607 1372 Arthropoda Malacostraca Decapoda Athanas nitescens + -
HF8.Leray_5586003 2864 Arthropoda Malacostraca Decapoda Eualus cranchii + +
HF8.Leray_5612792 37 Arthropoda Malacostraca Decapoda Eualus cranchii + -
HE1.Lobo_952576 3739 Arthropoda Malacostraca Decapoda Liocarcinus navigator + -
TF5.Lobo_6459477 1279 Arthropoda Malacostraca Decapoda Philocheras bispinosus bispinosus + +
HE4.Lobo_4138563 42 Arthropoda Malacostraca Decapoda Pisidia longicornis + +
HE8.Leray_7306131 2 Arthropoda Malacostraca Decapoda Processa modica + -
TS3.Lobo_1213146 17 Arthropoda Malacostraca Isopoda Asellus aquaticus + +
TF5.Leray_2897128 3 Arthropoda Maxillopoda Calanoida Acartia bifilosa - +
HF3.Leray_7129076 22 Arthropoda Maxillopoda Calanoida Acartia clausi + +
TF6.Leray_5332240 7399 Arthropoda Maxillopoda Calanoida Acartia tonsa + +
HF7.Leray_1683272 927 Arthropoda Maxillopoda Calanoida Acartia tonsa + +
HE2.Lobo_2010882 1 Arthropoda Maxillopoda Calanoida Anomalocera patersoni + -
TS2.Leray_4478240 2 Arthropoda Maxillopoda Calanoida Calanus euxinus - +
HF7.Lobo_5810493 41 Arthropoda Maxillopoda Calanoida Centropages hamatus + +
HF8.Lobo_5106754 82 Arthropoda Maxillopoda Calanoida Centropages typicus + +
HE8.Leray_7251655 1 Arthropoda Maxillopoda Calanoida Eurytemora affinis + -
HE7.Leray_3803390 5325 Arthropoda Maxillopoda Calanoida Paracalanus parvus + +
HF9.Leray_4411242 1 Arthropoda Maxillopoda Calanoida Pseudocalanus elongatus + -
TS4.Leray_7515925 2 Arthropoda Maxillopoda Calanoida Pseudocalanus elongatus - +
TS3.Lobo_1208165 1 Arthropoda Maxillopoda Calanoida Scolecithricella minor - +
TF5.Lobo_6373065 809 Arthropoda Maxillopoda Calanoida Temora longicornis + +
TF1.Leray_2453024 1 Arthropoda Maxillopoda Calanoida Temora longicornis - +
HF4.Leray_6242499 45 Arthropoda Maxillopoda Cyclopoida   + -
HF4.Leray_6206299 2 Arthropoda Maxillopoda Harpacticoida   + -
HE8.Lobo_823478 108 Arthropoda Maxillopoda Harpacticoida Harpacticoida sp. + -
TS3.Lobo_1208905 116 Arthropoda Maxillopoda Harpacticoida Harpacticus flexus + +
HE1.Lobo_995710 1 Arthropoda Maxillopoda Harpacticoida Tachidius discipes + -
HF4.Leray_6092514 1 Arthropoda Maxillopoda Poecilostomatoida   + -
HF9.Leray_4391714 11307 Arthropoda Maxillopoda Sessilia Balanus balanus + +
HF4.Leray_6295260 1079 Arthropoda Maxillopoda Sessilia Balanus balanus + +
HF7.Leray_1785147 2 Arthropoda Maxillopoda Sessilia Verruca stroemia + -
HE1.Leray_1117391 1 Arthropoda Pycnogonida Pantopoda Endeis spinosa + -
HE9.Lobo_2173983 63 Bryozoa Gymnolaemata Cheilostomatida Escharella immersa + -
HF7.Leray_1838377 98 Bryozoa Gymnolaemata Cheilostomatida Membranipora membranacea + -
HE3.Lobo_4881810 541 Bryozoa Gymnolaemata Cheilostomatida Scrupocellaria scruposa + -
HF6.Lobo_2617384 2 Bryozoa Gymnolaemata Ctenostomata Amathia gracilis + -
HF5.Lobo_3158598 5 Bryozoa Stenolaemata Cyclostomatida Crisia eburnea + -
HE6.Leray_2983148 31 Chaetognatha Sagittoidea Aphragmophora   + -
TS1.Leray_646185 73 Chordata Actinopterygii Gasterosteiformes Gasterosteus aculeatus + +
HF4.Lobo_208606 1 Chordata Actinopterygii Perciformes Ammodytes marinus + -
HF1.Leray_2487062 288 Chordata Actinopterygii Perciformes Ctenolabrus rupestris + -
HF3.Lobo_3538759 472 Chordata Actinopterygii Perciformes Gobius niger + -
TF1.Lobo_2807051 486 Chordata Actinopterygii Perciformes Lesueurigobius friesii + +
HF9.Lobo_7596943 8 Chordata Actinopterygii Perciformes Mullus surmuletus + -
HF5.Lobo_3273051 43 Chordata Actinopterygii Perciformes Trachinus draco + -
HE2.Lobo_1914646 81 Chordata Actinopterygii Pleuronectiformes Limanda limanda + -
HE8.Lobo_879846 265 Chordata Actinopterygii Pleuronectiformes Solea solea + -
HE8.Lobo_756051 34 Chordata Actinopterygii Salmoniformes Salmo trutta + -
HF3.Lobo_3595218 14 Chordata Ascidiacea Phlebobranchia Phallusia ingeria + -
HE8.Lobo_873511 131011 Chordata Leptocardii - Branchiostoma lanceolatum + +
TF3.Leray_6588680 3869 Cnidaria Anthozoa Pennatulacea Funiculina sp. + +
TF6.Lobo_5251371 1 Cnidaria Hydrozoa Anthoathecata Corymorpha nutans - +
HE9.Lobo_2164485 2 Cnidaria Hydrozoa Anthoathecata Lizzia blondina + -
TF6.Leray_5512978 1481 Cnidaria Hydrozoa Leptothecata Eutima gracilis + +
HF5.Lobo_3253786 232 Cnidaria Scyphozoa Semaeostomeae Aurelia aurita + +
HE3.Leray_361248 14 Cnidaria Scyphozoa Semaeostomeae Cyanea capillata + +
HE2.Leray_6553538 1 Cnidaria Staurozoa Stauromedusae   + -
HE2.Leray_6571642 184 Cnidaria Staurozoa Stauromedusae Craterolophus convolvulus + -
HE7.Leray_3802459 570 Echinodermata Asteroidea Forcipulatida Asterias rubens + -
HE3.Leray_388102 85 Echinodermata Asteroidea Forcipulatida Marthasterias glacialis + -
HF4.Leray_6293728 71 Echinodermata Echinoidea Clypeasteroida Echinocyamus pusillus + +
HE8.Leray_7326980 315 Echinodermata Echinoidea Echinoida Psammechinus miliaris + -
HE6.Lobo_7886165 1 Echinodermata Echinoidea Spatangoida   + -
TF3.Leray_6591339 2079 Echinodermata Echinoidea Spatangoida Brissopsis lyrifera + +
HF7.Leray_1843674 94 Echinodermata Echinoidea Spatangoida Echinocardium cordatum + -
TS5.Lobo_6025603 11 Echinodermata Holothuroidea Dendrochirotida Thyone fusus + +
TS3.Leray_6733304 1027065 Echinodermata Ophiuroidea Ophiurida   + +
TS1.Leray_663710 3 Echinodermata Ophiuroidea Ophiurida Acrocnida brachiata - +
TF1.Lobo_2726978 298 Echinodermata Ophiuroidea Ophiurida Ophiothrix fragilis - +
TF1.Leray_2426830 16603 Echinodermata Ophiuroidea Ophiurida Ophiura albida + +
TF5.Leray_2879711 1 Echinodermata Ophiuroidea Ophiurida Ophiura sarsii - +
HF3.Leray_7012508 44 Gastrotricha _ Macrodasyida Macrodasys sp. + -
HE1.Lobo_948618 14 Gnathostomulida   Bursovaginoidea Gnathostomula armata + -
TS2.Leray_4506244 1 Mollusca Bivalvia Lucinoida Thyasira equalis - +
HF3.Leray_7058438 371 Mollusca Bivalvia Myoida Corbula gibba + +
HE1.Lobo_894587 22 Mollusca Bivalvia Mytiloida Mytilus edulis + -
TS1.Lobo_4571224 4 Mollusca Bivalvia Nuculida Nucula nucleus - +
TS3.Leray_6727248 56213 Mollusca Bivalvia Veneroida Abra nitida + +
HE4.Lobo_4121128 25 Mollusca Bivalvia Veneroida Dosinia lupinus + +
TF5.Leray_2915847 1911 Mollusca Bivalvia Veneroida Kurtiella bidentata + +
TS6.Leray_5683559 2 Mollusca Bivalvia Veneroida Lucinoma borealis - +
HF1.Leray_2592679 33 Mollusca Bivalvia Veneroida Spisula subtruncata + -
HE7.Leray_3779267 14392 Mollusca Bivalvia Veneroida Tellimya ferruginosa + +
HF5.Lobo_3246886 1 Mollusca Cephalopoda Sepiida Sepietta neglecta + -
TS1.Lobo_4750257 2 Mollusca Gastropoda Cephalaspidea   - +
TS1.Lobo_4792606 2 Mollusca Gastropoda Cephalaspidea   - +
HF8.Lobo_5143779 2 Mollusca Gastropoda Littorinimorpha Euspira nitida + -
HE3.Lobo_4838288 34 Mollusca Gastropoda Neogastropoda Mangelia attenuata + +
HF6.Lobo_2622544 37 Mollusca Gastropoda Neogastropoda Nassarius nitidus + -
HE2.Lobo_1993552 50 Mollusca Gastropoda Nudibranchia   + -
HE6.Leray_2935130 2 Mollusca Gastropoda Nudibranchia   + -
HF1.Leray_2520121 559 Mollusca Gastropoda Nudibranchia Favorinus branchialis + -
HE2.Lobo_1978270 5 Mollusca Gastropoda Nudibranchia Onchidoris muricata + -
HE2.Lobo_1939813 155 Mollusca Gastropoda Nudibranchia Polycera quadrilineata + -
HE2.Lobo_1938412 10 Mollusca Gastropoda Nudibranchia Polycera quadrilineata + -
HF5.Leray_3991765 847 Mollusca Gastropoda Pulmonata Microhedyle glandulifera + -
HF4.Leray_6295954 2965 Mollusca Gastropoda Sacoglossa Elysia viridis + +
HF5.Lobo_3167773 166 Mollusca Gastropoda Sorbeoconcha Onoba semicostata + -
HE4.Lobo_4138137 2 Mollusca Gastropoda Sorbeoconcha Pusillina inconspicua + -
TS1.Lobo_4644275 2 Nemertea Anopla _ Cerebratulus sp. + +
HE4.Lobo_4203493 3 Nemertea Palaeonemertea _ Carinina ochracea + -
TF1.Lobo_2662495 1 Nemertea Palaeonemertea _ Hubrechtella dubia - +
HF7.Lobo_5876008 353 Phoronida _ _ Phoronis muelleri + -
HE8.Lobo_843910 13 Porifera Demospongiae Chondrillida Halisarca dujardini + -
HE4.Leray_3148053 1664 Porifera Demospongiae Suberitida Halichondria panicea + +
TS5.Leray_1547671 2628 Priapulida Priapulimorpha Priapulimorphida Priapulus caudatus + +
HF5.Leray_3885266 5 Rotifera Eurotatoria Flosculariaceae Testudinella clypeata + -
HE3.Leray_357208 2 Rotifera Monogononta Ploima   + -
HF8.Lobo_5184437 1 Sipuncula Sipunculidea Golfingiida Golfingia vulgaris + -
TS1.Lobo_4586276 14 Xenacoelomorpha _ Acoela Archaphanostoma sp. - +
TS3.Lobo_1178177 4 Xenacoelomorpha _ Acoela Childia macroposthium - +
HF9.Lobo_7719366 2 Xenacoelomorpha _ Acoela Haplogonaria viridis + -
HF9.Lobo_7734506 1 Xenacoelomorpha _ Acoela Notocelis Gullmarnensis + -
18Sa
OTU ID Nb of reads Phylum Class Order Species HI GF
TF5.SSU_460284 121639 Annelida _ _   + +
TS3.SSU_470635 59 Annelida _ _   - +
HF9.SSU_7624 12 Annelida Clitellata Enchytraeida Grania sp. + -
TF5.SSU_453927 2687 Annelida Clitellata Haplotaxida Tubificoides insularis + +
HF3.SSU_985477 1090 Annelida Polychaeta _ Aricia sp. + +
HF6.SSU_322303 10 Annelida Polychaeta _ Protodriloides chaetifer + -
HF4.SSU_622170 1 Annelida Polychaeta _ Scalibregma inflatum + -
HF9.SSU_25735 3753 Annelida Polychaeta _ Trilobodrilus heideri + -
TS3.SSU_480632 189 Annelida Polychaeta Phyllodocida Aphrodita sp. - +
HE6.SSU_371492 49226 Annelida Polychaeta Phyllodocida Brania sp. + +
HE4.SSU_913344 37252 Annelida Polychaeta Phyllodocida Glycera sp. + +
HF5.SSU_997904 64 Annelida Polychaeta Phyllodocida Glycinde armigera + +
TS5.SSU_870099 69 Annelida Polychaeta Phyllodocida Goniada maculata - +
TF6.SSU_42415 2 Annelida Polychaeta Phyllodocida Harmothoe imbricata - +
HE6.SSU_350003 5 Annelida Polychaeta Phyllodocida Myrianida sp. + -
HF6.SSU_324605 2 Annelida Polychaeta Phyllodocida Nereis pelagica + -
HE7.SSU_239005 67220 Annelida Polychaeta Phyllodocida Pisione remota + +
HE2.SSU_637269 49 Annelida Polychaeta Phyllodocida Platynereis dumerilii + -
HE8.SSU_832291 1 Annelida Polychaeta Phyllodocida Progoniada regularis + -
HE8.SSU_834197 1 Annelida Polychaeta Sabellida Fabriciola liguronis + -
HF2.SSU_202737 4 Annelida Polychaeta Sabellida Laeospira corallinae + -
HE2.SSU_640060 3 Annelida Polychaeta Sabellida Myriochele sp. + -
TS5.SSU_869292 123 Annelida Polychaeta Spionida Apistobranchus sp. - +
TS3.SSU_517096 1407 Annelida Polychaeta Spionida Laonice sp. - +
HE3.SSU_123438 1952 Annelida Polychaeta Spionida Spio sp. + +
TS5.SSU_882766 60 Annelida Polychaeta Terebellida Diplocirrus glaucus - +
HF2.SSU_193854 1 Annelida Polychaeta Terebellida Flabelligera sp. + -
TF6.SSU_63146 669 Annelida Polychaeta Terebellida Pectinaria sp. - +
TS5.SSU_883475 4155 Annelida Polychaeta Terebellida Terebellides stroemii - +
TF4.SSU_139713 193 Arthropoda Branchiopoda _   - +
HE5.SSU_184679 149 Arthropoda Malacostraca _   + -
HE8.SSU_832214 1 Arthropoda Malacostraca Decapoda Nikoides sp. + -
HF5.SSU_994971 7 Arthropoda Malacostraca Decapoda Praebebalia longidactyla + -
TF6.SSU_56595 65992 Arthropoda Maxillopoda _   + +
HF9.SSU_15855 31800 Arthropoda Maxillopoda _   + +
HF2.SSU_208480 21241 Arthropoda Maxillopoda _   + +
TS2.SSU_812824 433 Arthropoda Maxillopoda _   + +
TF3.SSU_955499 185 Arthropoda Maxillopoda _   + +
TF5.SSU_470101 360 Arthropoda Maxillopoda Harpacticoida Typhlamphiascus typhlops - +
HE1.SSU_864375 1160 Arthropoda Ostracoda Podocopida Hemicytherura kajiyamai + +
HE7.SSU_253407 2584 Arthropoda Ostracoda Podocopida Loxocorniculum mutsuense + +
HE5.SSU_181011 1 Arthropoda Pycnogonida Pantopoda Anoplodactylus californicus + -
HE2.SSU_646490 123 Arthropoda Pycnogonida Pantopoda Callipallene sp. + -
HE2.SSU_638224 23 Bryozoa _ _   + -
HE6.SSU_373369 2 Bryozoa Stenolaemata Cyclostomatida Plagioecia patina + -
HE1.SSU_850917 4 Bryozoa Stenolaemata Cyclostomatida Tubulipora lobifera + -
TF5.SSU_412099 18 Cephalorhyncha Kinorhyncha Homalorhagida Pycnophyes kielensis - +
HE7.SSU_239963 45 Chordata Actinopteri Perciformes Hypseleotris sp. + +
HE3.SSU_123107 4 Chordata Ascidiacea _   + -
HF9.SSU_12142 727 Chordata Ascidiacea Phlebobranchia Ascidiella sp. + +
HF4.SSU_611685 114 Chordata Ascidiacea Phlebobranchia Corella inflata + +
HE2.SSU_639404 209 Chordata Ascidiacea Stolidobranchia Molgula sp. + -
HE9.SSU_314754 616 Chordata Ascidiacea Stolidobranchia Styela plicata + -
HE8.SSU_834024 11058 Chordata Leptocardii _ Branchiostoma sp. + -
TF1.SSU_674740 2212 Cnidaria Anthozoa Actiniaria Nematostella vectensis + +
TS3.SSU_472524 2741 Cnidaria Hydrozoa _   + +
TS3.SSU_518760 7860 Cnidaria Hydrozoa Anthoathecata Euphysa sp. + +
HE2.SSU_639670 1 Cnidaria Hydrozoa Leptothecatha Abietinaria filicula + -
TF4.SSU_152912 61418 Echinodermata _ _   + +
HE5.SSU_186025 8038 Echinodermata _ _   + +
TF4.SSU_155631 5491 Echinodermata _ _   + +
TS5.SSU_881395 25 Echinodermata _ _   - +
HE4.SSU_914821 1 Echinodermata Holothuroidea Apodida Leptosynapta sp. + -
HF9.SSU_2577 1006 Gastrotricha _ Chaetonotida Chaetonotus sp. + +
HE7.SSU_244283 249 Gastrotricha _ Macrodasyida Diplodasys meloriae + -
HF5.SSU_996540 161 Gastrotricha _ Macrodasyida Lepidodasys sp. + -
HF5.SSU_995416 636 Gastrotricha _ Macrodasyida Macrodasys sp. + -
HF2.SSU_192734 479 Gastrotricha _ Macrodasyida Macrodasys sp. + -
HF7.SSU_385728 6934 Gastrotricha _ Macrodasyida Mesodasys sp. + +
HE7.SSU_242889 3013 Gastrotricha _ Macrodasyida Tetranchyroderma thysanophorum + -
HF1.SSU_770513 339 Gastrotricha _ Macrodasyida Thaumastoderma ramuliferum + -
HF1.SSU_760431 5 Gastrotricha _ Macrodasyida Urodasys sp. + -
TF6.SSU_44832 3816 Mollusca Bivalvia _   + +
HF2.SSU_208561 14 Mollusca Bivalvia Anomalodesmata   + +
HF8.SSU_788507 1 Mollusca Bivalvia Limoida Limaria hians + -
TF3.SSU_924397 11725 Mollusca Bivalvia Veneroida Abra sp. + +
HE9.SSU_317977 1982 Mollusca Bivalvia Verenoida Arctica islandica + +
TF4.SSU_132537 1581 Mollusca Gastropoda Neogastropoda Nassarius festivus + +
HF1.SSU_779114 65 Nematoda Chromadorea Araeolaimida Odontophora sp. + +
TF6.SSU_48167 2940 Nematoda Chromadorea Araeolaimida Sabatieria sp. + +
TF1.SSU_710679 639 Nematoda Chromadorea Chromadorida   + +
HF2.SSU_192072 2 Nematoda Chromadorea Chromadorida Chromadora nudicapitata + -
HF1.SSU_759758 4 Nematoda Chromadorea Plectida   + -
HF9.SSU_20251 636 Nematoda Desmodorida Microlaimidae   + +
HE3.SSU_124287 13 Nematoda Enoplea Enoplida Enoploides sp. + -
HE3.SSU_110275 8 Nematoda Enoplea Enoplida Enoplus sp. + -
HE5.SSU_188855 27 Nematoda Enoplea Enoplida Symplocostoma sp. + +
TS6.SSU_587229 493 Nematoda Enoplea Enoplida Viscosia viscosa + +
TF3.SSU_938615 642 Nemertea _ _   + +
TF6.SSU_49192 265 Nemertea Anopla _ Cerebratulus marginatus + +
HE4.SSU_908113 877 Nemertea Anopla _ Lineus bilineatus + +
HF9.SSU_3582 6 Nemertea Paleonemertea _ Callinera grandis + -
HE3.SSU_121696 12053 Nemertea Paleonemertea _ Cephalothrix filiformis + +
TF5.SSU_434928 1760 Nemertea Paleonemertea _ Hubrechtella dubia + +
TS2.SSU_818002 1 Platyhelminthes Rhabditophora Cestoda   - +
HE9.SSU_303121 1939 Platyhelminthes Rhabditophora Haplopharyngida Haplopharynx rostratus + -
HF1.SSU_773830 1 Platyhelminthes Rhabditophora Prolecithophora Allostoma neostiliferum + -
HE2.SSU_650311 8 Platyhelminthes Rhabditophora Prolecithophora Cylindrostoma sp. + -
HE5.SSU_177399 4 Platyhelminthes Rhabditophora Prolecithophora Euxinia baltica + -
HF9.SSU_23023 8367 Platyhelminthes Rhabditophora Prolecithophora Plagiostomum cinctum + +
TS2.SSU_822141 938 Platyhelminthes Rhabditophora Prolecithophora Plagiostomum cuticulata - +
TF6.SSU_52738 214 Platyhelminthes Rhabditophora Prolecithophora Plagiostomum striatum - +
TF5.SSU_433159 2 Platyhelminthes Rhabditophora Prolecithophora Ulianinia mollissima - +
HF9.SSU_24513 59 Platyhelminthes Rhabditophora Proseriata Monocelis lineata + +
HF2.SSU_201740 2 Platyhelminthes Rhabditophora Rhabdocoela Phonorhynchus helgolandicus + -
TS6.SSU_592673 245 Platyhelminthes Rhabditophora Rhabdocoela Proxenetes sp. + +
HF4.SSU_616041 771 Platyhelminthes Rhabditophora Seriata   + -
HE3.SSU_117223 181 Porifera Calcarea _   + +
HE7.SSU_223989 12 Porifera Demospongiae Chondrillida Halisarca dujardini + -
HF9.SSU_26977 8 Porifera Demospongiae Clionaida Spheciospongia vesparium + -
HE6.SSU_383060 3 Sipuncula Sipunculidea Golfingiida Phascolopsis gouldii + -
HE6.SSU_348954 2 Tardigrada Eutardigrada Parachela Halobiotus crispae + -
TF3.SSU_927927 2 Xenacoelomorpha _ _   - +
HE3.SSU_116025 28 Xenacoelomorpha _ Acoela Archaphanostoma sp. + +
HF9.SSU_26335 1 Xenacoelomorpha _ Acoela Archaphanostoma sp. + -
TS2.SSU_815721 2 Xenacoelomorpha _ Acoela Childia sp. - +
TS2.SSU_815970 1 Xenacoelomorpha _ Acoela Childia sp. - +
HF2.SSU_190395 2386 Xenacoelomorpha _ Acoela Eumecynostomum sp. + -
HF1.SSU_758202 74 Xenacoelomorpha _ Acoela Haplogonaria sp. + +
HF9.SSU_13290 5 Xenacoelomorpha _ Nemertodermatida Flagellophora apelti + -
TS6.SSU_601153 28 Xenacoelomorpha _ Nemertodermatida Nemertoderma westbladi - +

Invasive and alien species detected in the samples

Five alien species were detected in in the sample, of which two are considered invasive (in bold; Table 9), and the other three are on alert lists. The two invasive species (Acartia tonsa, a copepod, and Alexandrium ostenfefeldii, a dinoflagellate) could easily be overlooked in routine monitoring programs. Species within the genus Acartia are difficult to distinguish (Jensen 2010) and the invasive species can be confused with other native species. Also A. ostenfeldii is easily misidentified as other Alexandrium species; detailed thecal plate observation is often necessary for proper identification (Balech 1995).  This shows the potential of molecular techniques for monitoring  invasive species, and points to problems using traditional identification techniques. Many invasive species arrive in an area as spores, larvae or juveniles - all life stages that may be easily overlooked and problematic to identify to species level. Target barcoding of environmental DNA (eDNA) shows a great promise for detecting species without the need of costly sampling schemes. This would also allow for more random sampling in an area, increasing the probability of actually finding a species even when they occur in low numbers.

Invasive species (in bold) and species on alert lists (not bold) found in the samples. X indicates where the species were found.

Species

Phylum

COI

18S

Hållö island

Gullmarn Fjord

Hållö island

Gullmarn Fjord

Acartia tonsa

Arthropoda

x

x

 

 

Alexandrium ostenfeldii

Dinoflagellata

 

 

x

x

Bonnemaisonia hamifera

Rhodophyta

x

x

x

 

Penilia avirostris

Arthropoda

x

x

 

 

Thalassiosira punctigera

Bacillariophyta

x

 

 

 

Comparison of metabarcoding versus morphology-based identification of Xenacoelomorpha

Comparison of morphology-based assessment of Xenacoelomorpha diversity with metabarcoding using taxonomic assignments to the phylum level (with 80% similarity threshold; Suppl. materials 2, 3), shows that extraction procedures have strong impact on the effectiveness of morphology-based identification (Tables 10, 11). Using freshwater for extraction of Xenacoelomorpha rendered most of them unrecognizable and unidentifiable, but left their DNA intact and suitable for metabarcoding. No identifiable Xenacoelomorpha were found in the Hållö samples extracted using flotation with fresh water, while all specimens found in Gullmarn Fjord were treated together as one taxon "Acoela sp." for the lack of better alternative. Metabarcoding, on the other hand, recovered between 6 and 15 taxa (OTUs) from the Hållö samples  extracted using flotation with fresh water (Table 11), and up to 13 taxa (OTUs) from the same type of samples from the Gullmarn Fjord site (Table 11), depending on the barcoding region used. Just like for nematodes (see below), 18S barcodes always gave higher overall estimates of diversity (number of OTUs) compared to COI (Table 11). 18S also gave higher diversity estimates, compared to morphology-based identification for the Hållö samples extracted using flotation with MgCl2 (11 versus 7), but lower for the Gullmarn Fjord site samples extracted using siphoning (9 versus 15). COI Leray primers were less effective compared to the COI Lobo primers that recovered 2-6 OTUs more in all samples (Table 11). The most numerous of the morphologically identified species, Mecynostomum tenuissimum, was present with 120 specimens in the manually sorted samples, but was not detected at all in the 18S samples. Note that the 18S and COI sequences for all of the species identified in the visually sorted samples are present in the reference database. This raises the question of the efficiacy of using the SSU_FO4-SSU_R22 18 S fragment for metabarcoding of acoelomorphs. A recent study found a number of unknown xenacoelomorph taxa while data mining metabarcoding sequences from surveys of pelagial and deep benthic habitats (Arroyo et al. 2016). Unknown xenacoelomorph species may exist also at the moderate sampling depths we sampled in the Gullmarn Fjord. Our siphoning technique relies on migration of specimens to the sediment surface in response to hypoxia. It is possible that there are xenacoelomorphs with high tolerance for hypoxia that are not captured by the siphoning method, and thus would not be found in the manually sorted samples, but could be detected by metabarcoding of unprocessed samples. It should be noted that the extraction method used on the Hållö samples does not rely on migration of specimens to the surface.

Taxonomic composition and relative abundance (% of the total number of specimens) of Xenacoelomorpha species in Gullmarn Fjord and Hållö sites.

 

 

Gullmarn Fjord

Hållö

 

Taxon

Siphoning

Flotation with fresh water

Flotation with MgCl2 solution

Flotation with fresh water

 

Acoela

 

 

 

 

1

Haploposthia rubropunctata

1.03

0

0

0

2

Childia brachyposthium

3.78

0

0

0

3

Childia submaculatum

1.03

0

0

0

4

Childia trianguliferum

2.06

0

0

0

5

Childia crassum

3.44

0

0

0

6

Childia sp.

25.09

0

0

0

7

Mecynostomum tenuissimum

43.99

0

0

0

8

Mecynostomum auritum

0.34

0

0

0

9

cf. Eumecynostomum altitudi

4.81

0

0

0

10

Philactinoposthia sp.

0.34

0

0

0

11

Acoela sp.

2.06

100

88.71

0

12

Faerlea glomerata

3.09

0

 

 

13

Archaphanostoma sp.

0.34

0

0.81

0

14

Postmecynostomum glandulosum

0

0

2.42

0

15

Paramecynostomum sp.

0

0

0.81

0

16

Eumecynostomum macrobursalium

0

0

0.81

0

17

Isodiametra sp.

0

0

0.81

0

18

Haplogonaria viridis/Archocelis macrorhabditis

0

0

5.65

0

 

Nemertodermatida

 

 

 

 

19

Nemertoderma westbladi

8.25

0

0

0

20

Flagellophora apelti

0.34

0

0

0

Total number of Xenacoelomorpha taxa or OTUs distinguished based on morphology (Table 10), 18S and COI from different sampling sites and extraction methods (placement of OTUs is based on 80% similarity threshold, Suppl. materials 2, 3)

Site / extraction method

morphology-based

18S

COI (Lobo)

COI (Leray)

Hållo, flotation with MgCl2

7

11

8

6

Hållö, flotation with fresh water

0

15

11

6

Hållö, total

7

16

12

7

Gullmarn Fjord, siphoning

15

11

9

4

Gullmarn Fjord, flotation with fresh water

1

13

2

0

Gullmarn Fjord, total

15

19

10

4

Comparison of metabarcoding versus morphology-based identification of Nematoda

Both study sites are characterized by rich and diverse nematode fauna. The Hållö site had a total of 107 species of nematodes, belonging to 86 genera (Holovachov et al. 2017). Of these, 88 species belonging to 73 genera were found in samples extracted by flotation with a MgCl2 solution, and 101 species belonging to 83 genera were found in samples extracted by flotation with fresh water. The Gullmarn fjord site had a total of 113 nematode species of nematodes, belonging to 77 genera (Holovachov et al. 2017). Of these, 81 species belonging to 62 genera were found in samples extracted by siphoning, and 102 species belonging to 70 genera were found in samples extracted by flotation with fresh water. A certain small number of nematode individuals in each sample were not identified to species/genus/family, either due to their developmental stage or quality of preservation.

The final list of nematode OTUs includes 139 18S sequences. Only two 18S OTUs were positively identified using QIIME to species level using 97% similarity threshold: Viscosia viscosa (TS6.SSU58722) and Chromadora nudicapitata (HF2.SSU192072), six more were assigned to reference sequences identified to genus level only (Suppl. material 1). Only 22 COI sequences were assigned to the phylum Nematoda, and none was identified to species level.

When comparing the results of morphology-based assessment of nematode diversity with metabarcoding using taxonomic assignments to the phylum level in this particular study (with 80% similarity threshold; Suppl. materials 2, 3), the detailed and extensive examination of samples and morphology-based species identification provided more comprehensive estimates of nematode diversity (107 species in Hållö and 113 species in Gullmarn Fjord) than metabarcoding using either one of the molecular markers, independently of the extraction technique or locality (Table 12). Moreover, COI barcodes were much harder to obtain for marine nematodes using either one of the primers (16 OTUs in Hållö and 9 OTUs in Gullmarn Fjord using Lobo primers; 17 OTUs in Hållö and 4 OTUs in Gullmarn Fjord using Leray primers), comparing to 18S (95 OTUs in Hållö and 78 OTUs in Gullmarn Fjord site; Table 12). Due to the very limited reference databases available for marine nematodes, very few nematode OTUs can be identified to species or genus level, making it difficult to use metabarcoding data in ecological studies.

Total number of nematode taxa or OTUs distinguished based on morphology (after Holovachov et al. 2017), 18S and COI from different sampling sites and extraction methods (placement of OTUs is based on 80% similarity threshold, Suppl. materials 2, 3)

Site / extraction method

morphology-based

18S

COI (Lobo)

COI (Leray)

Hållo, flotation with MgCl2

88

71

12

11

Hållö, flotation with fresh water

101

78

14

14

Hållö, total

107

95

16

17

Gullmarn Fjord, siphoning

81

47

8

4

Gullmarn Fjord, flotation with fresh water

102

67

4

2

Gullmarn Fjord, total

113

78

9

4

 

Acknowledgements

We would like to thank the Genomics Core facility platform at the Sahlgrenska Academy, University of Gothenburg. The SweBoL (Swedish Barcode of Life) network and Christer Erséus are thanked for sharing barcode databases of Swedish invertebrates. We would also like to thank Nicolas Girard for help with scripting. This work was in part supported by the project "Systematics of Swedish free-living nematodes of the orders Desmodorida and Araeolaimida" (Swedish Taxonomy Initiative, ArtDatabanken, Sweden) awarded to OH, and by the Swedish Research Council project (2012-3446) 'Biodiversity genomics: Species identification pipelines for analyzing marine invertebrate larval stages, community structure, and trophic interactions’ awarded to SJB.

References

Supplementary materials

Suppl. material 1: OTUs identified to species level in the samples using 97% sequence similarity, all organism groups 
Authors:  Quiterie Haenel, Oleksandr Holovachov, Ulf Jondelius, Per Sundberg and Sarah J. Bourlat
Data type:  Occurrence records from Metabarcoding for Hållö island and Gullmarsfjord, Sweden.
Brief description: 

Sequence similarity search at 97% similarity allowed us to identify some OTUs to species level. 215 COI OTUs and 243 18S OTUs were identified to species from both sites (Hållö island and Gullmarsfjord).

Suppl. material 2: OTU table for 18S 
Authors:  Quiterie Haenel, Oleksandr Holovachov, Ulf Jondelius, Per Sundberg and Sarah J. Bourlat
Data type:  Metagenomic, OTU table
Brief description: 

OTU table showing all 18S OTUs, their taxonomic assignment at 80% similarity and number of reads per sample (HE: Hållö Flotation, HF: Hållö Flotation MgCl2, TS: Gullmarn Fjord Siphoning, TF: Gullmarn Fjord Flotation)

Suppl. material 3: OTU table for COI 
Authors:  Quiterie Haenel, Oleksandr Holovachov, Ulf Jondelius, Per Sundberg and Sarah J. Bourlat
Data type:  Metagenomic, OTU table
Brief description: 

OTU table showing all COI OTUs, their taxonomic assignment at 80% similarity and number of reads per sample (HE: Hållö Flotation, HF: Hållö Flotation MgCl2, TS: Gullmarn Fjord Siphoning, TF: Gullmarn Fjord Flotation)