Taxonomic relationship between Amolops minutus Orlov &amp; Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger &amp; Nguyen, 2019, with first record of A. minutus from China (Anura, Ranidae)

Shuo Liu; Truong Quang Nguyen; Minh Duc Le; Cuong The Pham; Anh Van Pham; Anh Van Pham; Mian Hou; Hongxin Zhou; Mingzhong Mo; Mei Li; Biao Li; Xiong Luo; Dingqi Rao; Song Li

doi:10.3897/BDJ.12.e129214

Biodiversity Data Journal : Taxonomy & Inventories

PDF

Taxonomy & Inventories

Taxonomic relationship between Amolops minutus Orlov & Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, with first record of A. minutus from China (Anura, Ranidae)

Shuo Liu^‡, Truong Quang Nguyen^§,|, Minh Duc Le^¶,#,¤, Cuong The Pham^§,|, Anh Van Pham^¶, Mian Hou^«, Hongxin Zhou^», Mingzhong Mo^˄, Mei Li^˅, Biao Li^˅, Xiong Luo^˅, Dingqi Rao^», Song Li^‡,¦

‡ Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

§ Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology, Hanoi, Vietnam

| Graduate University of Science and Technology, Vietnam Academy of Science and Technology, Hanoi, Vietnam

¶ Faculty of Environmental Sciences, University of Science, Vietnam National University, Hanoi, Vietnam

# Central Institute for Natural Resources and Environmental Studies, Vietnam National University, Hanoi, Vietnam

¤ Department of Herpetology, American Museum of Natural History, New York, United States of America

« College of Continuing (Online) Education, Sichuan Normal University, Chengdu, China

» Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

˄ Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province, Mengzi, China

˅ Guanyinshan Provincial Nature Reserve Management and Protection Bureau, Yuanyang, China

¦ Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

Corresponding author: Dingqi Rao (raodq@mail.kiz.ac.cn), Song Li (lis@mail.kiz.ac.cn)

Academic editor: Bin Wang

Received: 07 Jun 2024 | Accepted: 18 Sep 2024 | Published: 26 Sep 2024

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Liu S, Nguyen T, Le M, Pham C, Pham A, Hou M, Zhou H, Mo M, Li M, Li B, Luo X, Rao D, Li S (2024) Taxonomic relationship between Amolops minutus Orlov & Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, with first record of A. minutus from China (Anura, Ranidae). Biodiversity Data Journal 12: e129214. https://doi.org/10.3897/BDJ.12.e129214

Abstract

Background

Based on the examination of specimens of Amolops minutus Orlov & Ho, 2007 and A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, we found that there is no significant morphological difference between them. Phylogenetic analysis also showed that A. minutus and A. ottorum belong to the same taxon. In addition, we discovered the distribution of A. minutus in China.

New information

In this study, we provide the first molecular data of Amolops minutus and regard A. ottorum as a junior synonym of A. minutus. In addition, we report the first record of A. minutus from China, based on nine specimens collected from Guanyinshan Provincial Nature Reserve in southern Yunnan Province and present an updated diagnosis of this species, based on literature data and newly-collected specimens.

Keywords

16S, Guanyinshan Provincial Nature Reserve, morphology, synonym, taxonomy, torrent frogs

Introduction

The torrent frogs of Amolops Cope, 1865 inhabits torrents or waterfalls and they usually have an abdominal sucker in larvae and enlarged digital discs in adults (Fei et al. 2009, Fei et al. 2012). This genus is distributed broadly from southern and eastern Himalayas to Peninsular Malaysia (Dever et al. 2012, Pham et al. 2019, Wu et al. 2020, Mahony et al. 2022, Tang et al. 2023, Li et al. 2024, Frost 2024). It currently contains 86 recognised species (Frost 2024) and they are placed into ten species groups, namely the A. chayuensis group, A. daiyunensis group, A. hainanensis group, A. larutensis group, A. mantzorum group, A. marmoratus group, A. monticola group, A. ricketti group, A. spinapectoralis group and A. viridimaculatus group (Jiang et al. 2021, Wu et al. 2024).

The Amolops mantzorum group currently comprises twelve species, namely A. ailao Tang, Sun, Liu, Luo, Yu & Du, 2023, A. dafangensis Li, Liu, Ke, Cheng & Wang, 2024, A. granulosus (Liu & Hu, 1961), A. jinjiangensis Su, Yang & Li, 1986, A. lifanensis (Liu, 1945), A. loloensis (Liu, 1950), A. mantzorum (David, 1872), A. minutus Orlov & Ho, 2007, A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, A. sangzhiensis Qian, Xiang, Jiang, Yang & Gui, 2023, A. shuichengnicus Lyu & Wang, 2019 and A. tuberodepressus Liu & Yang, 2000 (Tang et al. 2023, Li et al. 2024).

Amolops minutus was described by Orlov and Ho (2007), based on morphological characteristics from Tam Duong District, Lai Chau Province, Vietnam, and molecular data of the species is unavailable. Amolops ottorum was discovered by Pham et al. (2019), based on two female specimens from Muong La District, Son La Province, Vietnam. The type localities of both species are located in north-western Vietnam and they are approximately 90 km distant from each other.

During our fieldwork in northern Vietnam, we collected fifteen specimens of Amolops minutus from its type locality in Lai Chau Province. As these specimens morphologically resemble A. ottorum, we suspected that these two species may be conspecific. To confirm their taxonomic status, we sequenced the homologous gene of the topotypic specimens of A. minutus and the type specimens of A. ottorum and phylogenetic analysis supported that they are conspecific with a genetic divergence of 0.7% (16S gene). Morphological examination of the type specimens of A. minutus showed that the original description of the species was not very accurate and there was no significant morphological difference between A. minutus and A. ottorum. According to the order of naming time, we herein consider A. ottorum as a junior synonym of A. minutus. In addition, we recently collected nine specimens of Amolops from Guanyinshan Provincial Nature Reserve in Yunnan Province, China. The sequences of these specimens clustered with those of the topotypic specimens of A. minutus. We herein report the record of A. minutus from China for the first time.

Materials and methods

Field surveys were conducted in Lai Chau Province, northern Vietnam, in 2020 and in Guanyinshan Provincial Nature Reserve, Yunnan Province, China, in 2023 and 2024. Voucher specimens collected from Vietnam were deposited at the Institute of Ecology and Biological Resources (IEBR), Hanoi, Vietnam and specimens collected from China were deposited at Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ), Kunming, China.

Measurements were taken with a digital caliper to the nearest 0.1 mm. The following morphological characteristics were used: snout-vent length (SVL), from the tip of the snout to the cloacal; head length (HL), from the rear of the lower jaw to the tip of the snout; head width (HW), at the greatest cranial width; snout-eye distance (ESL), from the tip of the snout to the anterior corner of the eye; eye diameter (ED), horizontal diameter of the eye; tympanum diameter (TD), horizontal diameter of the tympanum; fore-limb length (FLL), from the tip of the disc of the third finger to the axilla; hind-limb length (HLL), from the tip of the disc of the fourth toe to the groin; tibia length (TL), from the knee to the tarsus; foot and tarsus length (FOT), from the tip of the disc of the fourth toe to the posterior edge of the tibia.

Total genomic DNA was extracted from tissues. A fragment of the 16S ribosomal RNA (16S) gene was amplified and sequenced. The primer pairs L2188: 5’–AAAGTGGGCCTAAAAGCAGCCA–3’ and 16H1: 5’–CTCCGGTCTGAACTCAGATCACGTAGG–3’ (Hedges 1994, Matsui et al. 2006) and 16SAR: 5’-CGCCTGTTTAYCAAAAACAT-3’ and 16SBR: 5’-CCGGTYTGAACTCAGATCAYGT-3’ (Simon et al. 1994) were used in polymerase chain and cycling reactions. All newly-generated sequences have been deposited in GenBank and homologous sequences of other Amolops species were obtained from GenBank (Table 1).

Table 1.

Download as

CSV

XLSX

Sequences (16S) used for molecular analyses in this study.

Species	Voucher	Locality	Accession number
Amolops ailao	GXNU YU000001	Xinping, Yunnan, China	MN650751
Amolops ailao	GXNU YU000002	Xinping, Yunnan, China	MN650752
Amolops ailao	GXNU YU000003	Xinping, Yunnan, China	MN650753
Amolops ailao	GXNU YU000004	Xinping, Yunnan, China	MN650754
Amolops ailao	GXNU YU20160273	Xinping, Yunnan, China	MN650755
Amolops ailao	GXNU YU20160274	Xinping, Yunnan, China	MN650756
Amolops ailao	KIZ 2022041	Xinping, Yunnan, China	OP879227
Amolops dafangensis	MT DF20230601002	Dafang, Guizhou, China	OR936315
Amolops dafangensis	MT DF20230601001	Dafang, Guizhou, China	OR936314
Amolops dafangensis	MT DF20230601003	Dafang, Guizhou, China	OR936316
Amolops dafangensis	MT DF20230601004	Dafang, Guizhou, China	OR936317
Amolops dafangensis	MT DF20230601005	Dafang, Guizhou, China	OR936318
Amolops granulosus	SYS a005315	Hongya, Sichuan, China	MK604850
Amolops granulosus	SYS a005316	Hongya, Sichuan, China	MK604851
Amolops granulosus	20130258	Hongya, Sichuan, China	MH922934
Amolops jinjiangensis	SCUM 050435CHX	Deqing, Yunnan, China	EF453741
Amolops jinjiangensis	CIB-XM6120	Deqing, Yunnan, China	MZ292455
Amolops jinjiangensis	KIZ 047095	Chuxiong, Yunnan, China	MN953701
Amolops lifanensis	SYS a005378	Lixian, Sichuan, China	MK604870
Amolops loloensis	SYS a005351	Zhaojue, Sichuan, China	MK573806
Amolops loloensis	SYS a005346	Zhaojue, Sichuan, China	MK604854
Amolops loloensis	SYS a005347	Zhaojue, Sichuan, China	MK604855
Amolops mantzorum	SYS a005366	Baoxing, Sichuan, China	MK604862
Amolops mantzorum	SYS a005362	Baoxing, Sichuan, China	MG991893
Amolops mantzorum	SYS a005336	Hongya, Sichuan, China	MK573804
Amolops minutus	IEBR A.5142	Tam Duong, Lai Chau, Vietnam	PQ346023
Amolops minutus	IEBR A.6300	Tam Duong, Lai Chau, Vietnam	PQ346024
Amolops minutus	IEBR 4342 (Holotype of A. ottorum)	Muong La, Son La, Vietnam	PQ346025
Amolops minutus	TBU 06 (Paratype of A. ottorum)	Muong La, Son La, Vietnam	PQ346026
Amolops minutus	KIZ 2023064	Yuanyang, Yunnan, China	PQ346027
Amolops minutus	KIZ 2023065	Yuanyang, Yunnan, China	PQ346028
Amolops minutus	KIZ 2023066	Yuanyang, Yunnan, China	PQ346029
Amolops minutus	KIZ 2023067	Yuanyang, Yunnan, China	PQ346030
Amolops minutus	KIZ 2023068	Yuanyang, Yunnan, China	PQ346031
Amolops minutus	KIZ 2023069	Yuanyang, Yunnan, China	PQ346032
Amolops minutus	KIZ 2023070	Yuanyang, Yunnan, China	PQ346033
Amolops minutus	KIZ 2023102	Yuanyang, Yunnan, China	PQ346034
Amolops sangzhiensis	CSUFT 901	Sangzhi, Hunan, China	OQ079538
Amolops sangzhiensis	CSUFT 905	Sangzhi, Hunan, China	OQ079539
Amolops sangzhiensis	CSUFT 907	Sangzhi, Hunan, China	OQ079540
Amolops shuichengicus	SYS a004956	Shuicheng, Guizhou, China	MK604845
Amolops shuichengicus	SYS a004957	Shuicheng, Guizhou, China	MK604846
Amolops tuberodepressus	CIB-XM3125	Jingdong, Yunnan, China	KR559270
Amolops tuberodepressus	YU20160272	Xinping, Yunnan, China	MN650757
Amolops tuberodepressus	SYS a003931	Jingdong, Yunnan, China	MG991904
Amolops viridimaculatus	SYS a003813	Mt. Gaoligong, Yunnan, China	MK604836

Sequences were aligned using MAFFT 7.471 (Katoh and Standley 2013). The best fit substitution models were selected for Bayesian inference (BI) and maximum likelihood (ML) analyses, respectively, using the corrected Akaike Information Criterion (AICc) in ModelFinder (Kalyaanamoorthy et al. 2017). Bayesian inference was performed in MrBayes 3.2.7 (Ronquist et al. 2012) using the GTR+F+I+G4 model. Markov chains were run for 5,000,000 generations and sampled every 100 generations. The first 25% of the sampled trees was discarded as burn-in and the remaining trees were used to estimate Bayesian posterior probabilities (BPPs). Maximum likelihood analysis was performed in IQ-TREE 1.6.12 (Nguyen et al. 2015) with the TIM2+F+I+G4 model. Branch support was assessed using 5,000 ultrafast bootstrap replicates (UFB). The values of BPPs and UFB ≥ 95% are considered strong support for a clade (Ronquist et al. 2012, Nguyen et al. 2015). The uncorrected pairwise distances between species were calculated in MEGA 11 (Tamura et al. 2021).

Taxon treatment

Amolops minutus Orlov & Ho, 2007

Materials Download as CSV

scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5142
; basisOfRecord:
preserved specimen
; occurrenceID:
D85CF383-2685-58BF-B761-02FA97632765
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5143
; basisOfRecord:
preserved specimen
; occurrenceID:
220E4937-E84B-5FA0-B0DE-88D8039C4940
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5144
; basisOfRecord:
preserved specimen
; occurrenceID:
B1C10D49-59B9-5180-9D18-54C1BC04E812
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5145
; basisOfRecord:
preserved specimen
; occurrenceID:
24C4943D-F3CA-5BF0-B133-87C5CB7A1603
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5146
; basisOfRecord:
preserved specimen
; occurrenceID:
5CEB76ED-5893-519D-9452-E3D31153B175
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5147
; basisOfRecord:
preserved specimen
; occurrenceID:
C23C4993-DBF6-512A-BA1F-007CFABBA6BA
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5148
; basisOfRecord:
preserved specimen
; occurrenceID:
9319A5D0-DB68-5859-BD38-3E0623489A2C
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
IEBR A.5149
; basisOfRecord:
preserved specimen
; occurrenceID:
FD7307D9-575F-559F-B23E-5A7DBC70CC7B
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.5150
; basisOfRecord:
preserved specimen
; occurrenceID:
0F19C455-DBF5-5A49-9C5C-B047533698E6
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6299
; basisOfRecord:
preserved specimen
; occurrenceID:
14D431C9-4554-500C-BD95-364B33E742E2
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6300
; basisOfRecord:
preserved specimen
; occurrenceID:
AF82375D-18FF-54D1-B211-8AC61B87CF47
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6301
; basisOfRecord:
preserved specimen
; occurrenceID:
F4EB3970-70D7-5F67-8EFA-6A5734985252
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6302
; basisOfRecord:
preserved specimen
; occurrenceID:
B11DEB88-8877-5909-AC5D-806099C697B0
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6303
; basisOfRecord:
preserved specimen
; occurrenceID:
7B75B4E5-270B-5227-9928-67B20CB682FB
scientificName:
Amolops minutus
; country:
Vietnam
; stateProvince:
Lai Chau
; locality:
Ho Thau Village, Ho Thau Commune, Tam Duong District
; verbatimElevation:
2440 m
; verbatimCoordinates:
22°24′42″N 103°36′35″E
; eventRemarks:
collected by Anh Van Pham, Chung Van Hoang, Tien Phan Quang, and Nenh Ba Sung in May 2020
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
IEBR A.6304
; basisOfRecord:
preserved specimen
; occurrenceID:
B7189F6D-EFF6-5110-A7B6-DE4DBB8C2E2E
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2023064
; basisOfRecord:
preserved specimen
; occurrenceID:
518014E8-3FCE-56F9-B84A-BC2D935425CA
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2023065
; basisOfRecord:
preserved specimen
; occurrenceID:
0FC83528-7760-5F20-84F7-3B4465EEECBD
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2023066
; basisOfRecord:
preserved specimen
; occurrenceID:
89044FE6-F2FA-5991-9BC8-A22EBEFFDD45
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2023067
; basisOfRecord:
preserved specimen
; occurrenceID:
DFC7F447-5B74-5FFD-9254-C729C75CC841
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2023068
; basisOfRecord:
preserved specimen
; occurrenceID:
DC4AB2B4-70F8-516E-A561-24B34E657C26
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
KIZ 2023069
; basisOfRecord:
preserved specimen
; occurrenceID:
2467D2C6-A15C-5EE0-8C7E-B63F9F489211
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2410 m
; verbatimCoordinates:
23°0'57"N 102°56'57"E
; eventRemarks:
collected by Shuo Liu on 16 May 2023
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
KIZ 2023070
; basisOfRecord:
preserved specimen
; occurrenceID:
FDAC765F-29ED-5487-9B51-46F6331679CF
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Xiaoxinjie Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2490 m
; verbatimCoordinates:
22°59'20"N 102°59'26"E
; eventRemarks:
collected by Shuo Liu on 20 May 2023
; individualCount:
1
; sex:
female
; lifeStage:
adult
; catalogNumber:
KIZ 2023102
; basisOfRecord:
preserved specimen
; occurrenceID:
A891C6DE-2573-5D59-A021-CE1C3EA24FD3
scientificName:
Amolops minutus
; country:
China
; stateProvince:
Yunnan
; locality:
Ganiang Township, Yuanyang County, Honghe Prefecture
; verbatimElevation:
2200 m
; verbatimCoordinates:
23°2'54"N 102°54'45"E
; eventRemarks:
collected by Shuo Liu on 13 April 2024
; individualCount:
1
; sex:
male
; lifeStage:
adult
; catalogNumber:
KIZ 2024112
; basisOfRecord:
preserved specimen
; occurrenceID:
F47A3080-9562-550A-B16F-1828B9EA9F16

Extended diagnosis

This species is assigned to the Amolops mantzorum species group on the basis of the absence of a dorsolateral fold and the absence of circum-marginal groove on the disc of the first finger. It is distinguishable from other members of this species group by a combination of the following morphological characters: size small (SVL 29.7–38.3 mm in adult males and 38.5–51.1 mm in adult females); head moderate large, longer than wide (HL/SVL 0.33–0.37 in males and 0.31–0.35 in females, HW/SVL 0.28–0.33 in males and 0.26–0.32 in females); tympanum distinct, small (TD/HL 0.10–0.23 in males and 0.09–0.27 in females); pineal spot present; pupil oval, horizontal; vomerine teeth absent or weakly developed; vocal sac absent in males; fore-limbs robust (FLL/SVL 0.70–0.87 in males and 0.67–0.85 in females), relative finger lengths I < II < IV < III; hind-limbs long (HLL/SVL 1.79–2.09 in males and 1.70–2.00 in females), relative toe length I < II < III < V < IV; dorsal skin smooth, with a few flattened tubercles on flanks and posterior surface of dorsum; supratympanic fold absent or weakly developed; true dorsolateral folds absent, but dorsolateral glandular folds distinct; circummarginal groove on tip of first finger absent; inner metatarsal tubercle small; outer metatarsal tubercle absent; nuptial pad present on finger I of adult males. Colour of dorsal surface from nearly uniform green to mostly brown, flanks mostly green, dark bars on dorsal limbs distinct or indistinct.

Distribution

Amolops minutus is currently known from Lai Chau and Son La provinces in northern Vietnam and Guanyinshan Provincial Nature Reserve in Yuanyang County, Honghe Prefecture, Yunnan Province, China (Fig. 1).

Figure 1.

Map showing the type locality (black star) of Amolops minutus in Lai Chau Province, Vietnam, the type locality (black triangle) of Amolops ottorum in Son La Province, Vietnam and the collection site (black dot) of the specimens from Guanyinshan Provincial Nature Reserve in Yuanyang County, Honghe Prefecture, Yunnan Province, China.

Analysis

Morphological characteristics of the specimens collected from the type locality of Amolops minutus in Lai Chau Province (Vietnam) were similar to those in the original description of Orlov and Ho (2007), except for the vomerine teeth which were absent or weakly developed and the gular pouches being absent in males (vs. vomerine teeth strongly developed and paired gular pouches present in males in the original description) and small variations in the relative size of the tympanum and the relative length of the fore-limbs (Table 2). However, we found that the type specimens of A. minutus have no vomerine teeth or only weakly-developed vomerine teeth and no gular pouches in males (Fig. 2), which were not as described in Orlov and Ho (2007).

Table 2.

Download as

CSV

XLSX

Comparisons amongst the type specimens of Amolops minutus, the topotypic specimens of A. minutus, the type specimens of A. ottorum and the specimens of A. minutus collected from China. Measurements in mm. Abbreviations defined in the text. Data for the type specimens of A. minutus and A. ottorum were from the original descriptions (Orlov and Ho 2007; Pham et al. 2019).

	Types of Amolops minutus		Topotypes of Amolops minutus		Types of Amolops ottorum	Amolops minutus from China
	Males (n = 8)	Females (n = 5)	Males (n = 8)	Females (n = 7)	Females (n = 2)	Males (n = 6)	Females (n = 3)
SVL	29.7–36.4	38.5–50.2	30.8–34.0	42.5–47.5	47.5–48.2	34.6–38.3	46.7–51.1
HL	11.0–12.9	12.5–15.7	10.8–12.0	14.3–16.0	15.1–16.0	12.2–13.6	16.0–17.1
HW	9.7–11.4	10.1–14.4	10.0–11.0	13.5–14.0	14.6–14.9	10.9–11.8	15.1–16.6
ED	4.3–5.0	5.4–6.4	4.7–5.0	5.5–6.0	5.7–5.8	4.4–4.7	5.5–5.6
TD	2.1–2.7	3.1–3.5	1.8–2.0	2.2–2.4	2.1	1.3–1.4	1.5–1.8
ESL	4.8–5.4	6.5–7.6	4.9–5.4	6.4–7.0	6.8–7.0	5.6–6.0	7.2–7.7
FLL	25.7–28.2	32.7–40.3	22.5–25.5	30.5–32.5	32.3–32.5	26.6–28.6	34.8–38.8
HLL	59.5–67.2	74.3–85.5	58.2–65.6	81.5–87.7	82.3–83.5	72.4–75.9	92.3–99.3
TL	17.7–20.3	22.3–25.6	17.4–20.4	24.8–27.0	27.2–27.8	21.6–22.7	27.0–29.1
FOT	25.7–29.4	31.2–36.0	25.0–28.6	34.8–37.2	37.4–38.0	30.5–32.2	39.2–42.6
HL/SVL	0.33–0.37	0.31–0.33	0.34–0.36	0.32–0.35	0.32–0.33	0.35–0.36	0.33–0.34
HW/SVL	0.28–0.33	0.26–0.31	0.30–0.33	0.29–0.32	0.31	0.30–0.32	0.32
ESL/SVL	0.14–0.17	0.15–0.17	0.15–0.16	0.15	0.14–0.15	0.15–0.16	0.14–0.16
ED/HL	0.36–0.44	0.36–0.44	0.41–0.44	0.36–0.39	0.36–0.38	0.34–0.36	0.33–0.34
TD/HL	0.19–0.23	0.20–0.27	0.17	0.14–0.16	0.13–0.14	0.10–0.11	0.09–0.11
FLL/SVL	0.77–0.87	0.71–0.85	0.70–0.75	0.68–0.72	0.67–0.68	0.72–0.77	0.73–0.76
HLL/SVL	1.79–2.00	1.70–1.93	1.87–1.94	1.81–1.92	1.71–1.76	1.98–2.09	1.85–2.00
TL/SVL	0.54–0.60	0.51–0.58	0.56–0.60	0.54–0.59	0.57–0.58	0.59–0.63	0.54–0.59
FOT/SVL	0.77–0.86	0.72–0.81	0.78–0.84	0.76–0.82	0.78–0.80	0.83–0.88	0.79–0.86

Figure 2.

Dorsal view (A), ventral view (B), close-up view the gular region (C) and close-up view of the upper oral wall (D) of the paratype (ZISP 7615) of Amolops minutus; and dorsal view (E), ventral view (F), close-up view the gular region (G) and close-up view of the upper oral wall (H) of the topotypic specimen (IEBR A.5142) of A. minutus.

Moreover, morphological comparison showed that the type specimens of A. ottorum from Son La Province (Vietnam) and the newly-collected specimens of Amolops from Yunnan Province (China) are very similar to A. minutus (Table 2).

The newly-generated sequences are approximately 850 bp or 570 bp. BI and ML analyses yielded similar results. The sequences of the type specimens of Amolops ottorum from Son La Province (Vietnam), the specimens collected from the type locality of A. minutus in Lai Chau Province (Vietnam) and the Amolops specimens collected from Yunnan Province (China), clustered in the same clade with strong support by both BI and ML (BPPs = 1, UFB = 96) (Fig. 3). The uncorrected pairwise distance between the sequences of the type specimens of A. ottorum and the specimens collected from the type locality of A. minutus was 0.7% and the uncorrected pairwise distance between the sequences of the Amolops specimens collected from Yunnan and the specimens collected from the type locality of A. minutus was 0.6% (Table 3).

Table 3.

Download as

CSV

XLSX

Uncorrected pairwise genetic distances (%) estimated from 16S rRNA sequences.

	1	2	3	4	5	6	7	8	9	10	11	12
1 Types of Amolops ottorum
2 Topotypes of Amolops minutus	0.7
3 Amolops minutus from China	0.6	0.6
4 Amolops ailao	1.2	1.8	1.6
5 Amolops dafangensis	2.1	1.9	1.8	1.7
6 Amolops granulosus	2.2	2.8	2.5	2.7	1.8
7 Amolops jinjiangensis	1.6	1.6	1.4	2.1	1.1	2.1
8 Amolops lifanensis	5.8	8.0	8.4	8.3	4.8	7.6	7.3
9 Amolops loloensis	2.0	2.1	1.8	2.3	1.5	1.9	1.1	7.6
10 Amolops mantzorum	2.0	2.2	1.7	1.9	2.2	2.5	1.9	8.5	2.0
11 Amolops sangzhiensis	1.4	1.9	1.6	1.8	0.8	2.0	0.8	7.8	1.4	1.7
12 Amolops shuichengicus	1.6	2.8	2.7	2.9	1.7	2.7	1.9	7.9	2.4	3.0	1.8
13 Amolops tuberodepressus	1.8	2.7	2.2	2.5	2.1	2.1	1.7	8.2	1.8	1.8	1.8	2.8

Figure 3.

Bayesian phylogram of the Amolops mantzorum group inferred from the 16S rRNA sequences. Numbers after and behind “/” are BPPs and UFB values (only above 0.90/90 are shown), respectively.

Based on morphological data and phylogenetic analysis, we assign the specimens collected from the type locality of A. minutus in Lai Chau Province (Vietnam) and from Yunnan Province (China) to A. minutus and regard A. ottorum as a junior synonym of A. minutus.

Discussion

As some discrepancies between the morphological characters of the specimens we collected from the type locality of Amolops minutus and the original descriptions of this species, in order to verify whether the specimens we collected belong to A. minutus, we rely on the type specimen of this species. Re-examination of the type specimens verified that the specimens collected from the type locality A. minutus belong to A. minutus. In addition, morphological comparison between the type specimens of A. ottorum and the type and topotypic specimens of A. minutus showed that these two species could not be clearly distinguished. Combined with phylogenetic analysis, we confirmed that A. ottorum and A. minutus are conspecific and A. ottorum should be regarded as a junior synonym of A. minutus. Moreover, we found that A. minutus is also distributed in China and the colouration of this species in life was quite variable (Fig. 4), which extends the distribution range and diagnosis of this species.

Figure 4.

The specimens of Amolops minutus in life. A, the male topotypic specimen (IEBR A.5142); B, the female topotypic specimen (IEBR A.6300); C, the male specimen (KIZ 2024112) from China; D, the male specimen (KIZ 2023067) from China; E, the male specimen (KIZ 2023066) from China; F, the female specimen (KIZ 2023070) from China.

Guanyinshan Provincial Nature Reserve is located in southern Yunnan Province of China, with relatively high altitudes (approximately 1640–2746 m) and well-preserved natural habitat. There have been few previous field surveys in this nature reserve, resulting in a serious underestimation of its species diversity. Some new species of plants and animals have been discovered in this nature reserve recently, such as Primula weimingii Bin Yang & Y.H. Tan and Pareas guanyinshanensis Liu, Mo, Li, Li, Luo, Rao & Li, 2024 (Yang et al. 2023, Liu et al. 2024). The discovery of Amolops minutus in this nature reserve further enriches its species diversity. More field surveys will likely reveal more new species or new records of amphibians from this nature reserve.

Acknowledgements

We thank the forest rangers of Guanyinshan Provincial Nature Reserve for their assistance in the fieldwork. We are grateful to the directorates of the Forest Protection Department of Lai Chau Province and Tam Duong District for supporting our fieldwork. We thank C. V. Hoang, T. Q. Phan (Ha Noi) and N. B. Sung (Son La) for their assistance in the field. We express our gratitude to T. T. Nguyen (Institute of Genome Research, VAST) and Nikolai Orlov (Zoological Institute, Russian Academy of Sciences) for sharing information and loan of type specimens. We would like to thank the editors and reviewers for their valuable comments on the manuscript. This work was supported by the project of Yuanyang Guanyin Mountains Provincial Nature Reserve Integrative Scientific Expedition (grant no. E2HX105B), the Position of Bioclassonomist of Chinese Academy of Sciences (grant no. CAS-TAX-24-055), the National Natural Science Foundation Project: Classificatory and Phylogenetic Studies on the Amolops frogs of China (grant no. NSFC-31772424), the Small Grants Programme by the ASEAN Centre for Biodiversity II (Small-grant in the Hoang Lien National Park) under Grant Number 2023 VNM HLNP 11 to A.V. Pham and the project of the Ministry of Ecology and Environment of China: Investigation and assessment of amphibians and reptiles in southern Yunnan.

References

Dever J, Fuiten A, Konu Ö, Wilkinson J (2012)

Cryptic torrent frogs of Myanmar: An examination of the Amolops marmoratus species complex with the resurrection of Amolops afghanus and the identification of a new species

Copeia

2012

(

‑

. https://doi.org/10.1643/ch-10-180

Fei L, Hu S, Ye C, Huang y (2009)

Fauna Sinica. Amphibia Vol. 2 Anura

Science Press

Beijing

. [ISBN

9787030232700

]

Fei L, Ye C, Jiang J (2012)

Colored atlas of Chinese amphibians and their distributions

Sichuan Publishing House of Science & Technology

Chengdu

. [ISBN

9787536475458

]

Frost D (2024)

Amphibian species of the world: an online reference. Version 6.1.

http://research.amnh.org/herpetology/amphibia/index.html. Accessed on: 2024-6-02.

Hedges S (1994)

Molecular evidence for the origin of birds

Proceedings of the National Academy of Sciences

(

2621

‑

2624

. https://doi.org/10.1073/pnas.91.7.2621

Jiang K, Ren J, Lyu Z, Wang D, Wang Z, Lv K, Wu J, Li J (2021)

Taxonomic revision of Amolops chunganensis (Pope, 1929) (Amphibia: Anura) and description of a new species from southwestern China, with discussion on Amolops monticola group and assignment of species groups of the genus Amolops

Zoological Research

(

574

‑

591

. https://doi.org/10.24272/j.issn.2095-8137.2021.107

Kalyaanamoorthy S, Minh B, Wong T, von Haeseler A, Jermiin L (2017)

ModelFinder: fast model selection for accurate phylogenetic estimates

Nature Methods

(

587

‑

589

. https://doi.org/10.1038/nmeth.4285

Katoh K, Standley D (2013)

MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability

Molecular Biology and Evolution

(

772

‑

780

. https://doi.org/10.1093/molbev/mst010

Li S, Liu J, Ke X, Cheng G, Wang B (2024)

A new species of Amolops (Amphibia, Anura, Ranidae) from Guizhou Province, China

ZooKeys

1189

‑

. https://doi.org/10.3897/zookeys.1189.115621

Liu S, Mo M, Li M, Li B, Luo X, Rao D, Li S (2024)

Description of a new species of the Pareas hamptoni complex from Yunnan, China, with confirmation of P. hamptoni sensu stricto in China (Squamata, Pareidae)

Animals

421

. https://doi.org/10.3390/ani14030421

Mahony S, Nidup T, Streicher J, Teeling E, Kamei R (2022)

A review of torrent frogs (Amolops: Ranidae) from Bhutan, the description of a new species, and reassessment of the taxonomic validity of some A. viridimaculatus group species aided by archival DNA sequences of century-old type specimens

The Herpetological Journal

(

142

‑

175

. https://doi.org/10.33256/32.3.142175

Matsui M, Shimada T, Liu W, Maryati M, Khonsue W, Orlov N (2006)

Phylogenetic relationships of Oriental torrent frogs in the genus Amolops and its allies (Amphibia, Anura, Ranidae)

Molecular Phylogenetics and Evolution

(

659

‑

666

. https://doi.org/10.1016/j.ympev.2005.11.019

Nguyen L, Schmidt H, von Haeseler A, Minh B (2015)

IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies

Molecular Biology and Evolution

(

268

‑

274

. https://doi.org/10.1093/molbev/msu300

Orlov N, Ho C (2007)

Two new species of cascade ranids of Amolops genus (Amphibia: Anura: Ranidae) from Lai Chau Province (northwest Vietnam)

Russian Journal of Herpetology

(

211

‑

228

. https://doi.org/10.30906/1026-2296-2007-14-3-211-228

Pham A, Sung N, Pham C, Le M, Ziegler T, Nguyen T (2019)

A new species of Amolops (Anura: Ranidae) from Vietnam

The Raffles Bulletin of Zoology

363

‑

377

. https://doi.org/10.5281/zenodo.4576230

Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Höhna S, Larget B, Liu L, Suchard M, Huelsenbeck J (2012)

MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space

Systematic Biology

(

539

‑

542

. https://doi.org/10.1093/sysbio/sys029

Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994)

Evolution, Weighting, and Phylogenetic Utility of Mitochondrial Gene Sequences and a Compilation of Conserved Polymerase Chain Reaction Primers

Annals of the Entomological Society of America

(

651

‑

701

. https://doi.org/10.1093/aesa/87.6.651

Tamura K, Stecher G, Kumar S (2021)

MEGA11: Molecular Evolutionary Genetics Analysis Version 11

Molecular Biology and Evolution

(

3022

‑

3027

. https://doi.org/10.1093/molbev/msab120

Tang S, Sun T, Liu S, Luo S, Yu G, Du L (2023)

A new species of cascade frog (Anura: Ranidae: Amolops) from central Yunnan, China

Zoological Letters

. https://doi.org/10.1186/s40851-023-00214-9

Wu Y, Yan F, Stuart B, Prendini E, Suwannapoom C, Dahn H, Zhang B, Cai H, Xu Y, Jiang K, Chen H, Lemmon A, Lemmon E, Raxworthy C, Orlov N, Murphy R, Che J (2020)

A combined approach of mitochondrial DNA and anchored nuclear phylogenomics sheds light on unrecognized diversity, phylogeny, and historical biogeography of the torrent frogs, genus Amolops (Anura: Ranidae)

Molecular Phylogenetics and Evolution

144

(

106701

‑

. https://doi.org/10.1016/j.ympev.2020.106789

Wu Y, Yu Z, Lu C, Zhang Y, Dong W, Liu X, Kilunda F, Xiong Y, Jiang Y, Ouyang H, Fu Z, He Y, Yuan Z, Che J (2024)

A new species of the genus Amolops (Amphibia: Ranidae) and the first national record of Amolops vitreus from China

Vertebrate Zoology

343

‑

357

. https://doi.org/10.3897/vz.74.e108013

Yang B, Zuo Y, Li M, Quan D, Wang L, Zhou S, He G, Tan Y (2023)

Primula weimingii (Primulaceae), a new species from Yunnan, China

Taiwania

(

435

‑

438

. https://doi.org/10.6165/tai.2023.68.435

Supplementary material

Endnotes