Biodiversity Data Journal : Taxonomy & Inventories
PDF
Taxonomy & Inventories
New molecular evidence of the genus Hydrurus (Chrysophyceae) and descriptions of Hydrurus foetidus (Villars) Trevisan on the basis of morphology and phylogeny
expand article infoJunxue Hao‡, Yalu An‡, Fangru Nan‡, Junping Lv‡, Qi Liu‡, Xudong Liu‡, Shulian Xie‡, Jia Feng‡
‡ Shanxi University, Taiyuan, China
Corresponding author: Jia Feng (fengj@sxu.edu.cn)
Academic editor: Anne Thessen
Received: 18 Sep 2024 | Accepted: 23 Oct 2024 | Published: 01 Nov 2024
© 2024 Junxue Hao, Yalu An, Fangru Nan, Junping Lv, Qi Liu, Xudong Liu, Shulian Xie, Jia Feng
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Hao J, An Y, Nan F, Lv J, Liu Q, Liu X, Xie S, Feng J (2024) New molecular evidence of the genus Hydrurus (Chrysophyceae) and descriptions of Hydrurus foetidus (Villars) Trevisan on the basis of morphology and phylogeny. Biodiversity Data Journal 12: e137389. https://doi.org/10.3897/BDJ.12.e137389
 Open Access

Abstract

Background

The genus Hydrurus contains a solitary species, Hydrurus foetidus. Its thalli exhibit a remarkable structure, consisting of a firm central axis surrounded by peripheral branches, all enveloped within a viscous, gelatinous coating. Molecular data pertaining to the genus Hydrurus are scarce, necessitating further investigation into its phylogenetic relationships.

New information

A new site with benthic freshwater alga Hydrurus foetidus (Villars) Trevisan has been discovered in the Fenhe River in Shanxi Province, China. The physical and chemical parameters of water were meticulously measured and documented. Detailed morphological observations were conducted on the specimen, measuring different cell categories. The SSU, LSU, ITS and rbcL DNA sequence data of H. foetidus collected from Shanxi were determined. An extensive three-gene phylogenetic tree was constructed, revealing a strong relationship between the specimen in this study and H. foetidus specimen from Norway. Time-calibrated molecular phylogenetic analysis further indicated that the genus Hydrurus diverged approximately 125 million years ago (Early Cretaceous), while the two H. foetidus strains from Shanxi, China and Norway diverged approximately 6 million years ago (Neogene). The results of this study supplement new molecular evidence for H. foetidus and contribute significantly to our understanding of the geographical distribution and evolutionary history of the genus Hydrurus.

Keywords

China, Chrysophyceae, evolution, Hydrurus, morphology, molecular phylogeny

Introduction

Hydrurus C. Agardh, the only genus of Hydruraceae, was established in 1824 (Agardh 1824). It contains only one species, H. foetidus (Villars) Trevisan (Wei 2018). Hydrurus foetidus exhibits a macroscopic and benthic nature, which differs from other golden algae (Rott et al. 2006a, Klaveness et al. 2011). Hydrurus is widely distributed worldwide, especially in the Northern Hemisphere (Kristiansen and Preisig 2011, Klaveness 2017, Klaveness 2019). As a typical cold-water species, H. foetidus can be found in cold mountain streams and lowland rivers during early spring and winter, as well as in rivers with consistently low temperatures throughout summer or autumn (Ward 1994, Rott et al. 2006b, Kristiansen and Preisig 2011, Klaveness 2017, Klaveness 2019). During winter, a noteworthy phenomenon arises when the psychrophilic chrysophyte, H. foetidus, causes blooms in melting snow (Remias et al. 2013, Lutz et al. 2018, Remias et al. 2020).

H. foetidus typically attaches to stones and forms bushy thalli on riverbed materials (Kristiansen and Preisig 2011). Hydrurus is often sensitive to the environment and temperature, light and carbon dioxide are key factors affecting its growth (Bursa 1934, Kawecka 2003, Nozaki et al. 2020). Notably, the optimal temperature range for the growth of Hydrurus has been reported to be 2–12℃ (Klaveness 2019). Although algae are multicellular, single cells within the thalli can slide in polysaccharide tubes or be released (Klaveness et al. 2011, Bråte et al. 2019). In addition, each cell typically possesses multiple contractive vacuoles (Klaveness 2019). Furthermore, Hydrurus holds immense potential as a rich food source for fungi, protists and insect larvae, providing valuable nutrients, such as polyunsaturated fatty acids and polysaccharides (Milner et al. 2001, Zah et al. 2001, Milner et al. 2009, Klaveness 2017).

Phylogenetic studies of the genus Hydrurus have been limited by a lack of molecular evidence. Only three sequences (one of 5S rRNA, one of 18S rRNA and another of 28S rRNA) are available via the National Centre for Biotechnology Information (NCBI) GenBank database (Lim et al. 1986, Klaveness et al. 2011). Although Bråte et al. (2019) proposed an extensive next-generation sequencing dataset, they did not delve into the analysis of genome sequences; thus, the analysis of genome sequences remains unexplored. Molecular clock analyses and specific molecular markers, such as ITS and rbcL, have been employed in early chrysophyte studies (Jo et al. 2013, Siver et al. 2015, Jo et al. 2016, Čertnerová et al. 2019, Škaloud et al. 2020). However, these methods have yet to be widely applied in the genus Hydrurus. Additionally, the absence of molecular sequences and limited fossil records hinder a clear understanding of the position and evolutionary history of the genus Hydrurus within the Chrysophyceae. To accurately determine the phylogenetic position of Hydrurus, we need more sequence data and explore additional molecular markers.

In this study, we conducted time-calibrated molecular phylogeny, based on concatenated SSU, LSU and rbcL rDNA sequences to investigate the classification and evolution of the genus Hydrurus. This study aimed to:

  1. describe H. foetidus collected from China, based on morphological characteristics;
  2. provide new molecular data for H. foetidus and infer the phylogenetic relationships amongst chrysophyte species;
  3. comprehend the species diversity and infer the divergence time of Hydrurus species;
  4. contribute to the geographical distribution of Hydrurus and enhance biodiversity records of freshwater chrysophytes.

Materials and methods

Sample collection

The materials were collected from the Shanxi Province of China in March 2023 (Fig. 1). The materials were directly picked up from stones using knives and tweezers and subsequently transferred to the laboratory. Water quality parameters, including water temperature (WT), pH, salinity, Secchi depth (SD), dissolved oxygen (DO), electronic conductivity (EC) and total dissolved solids (TDS), were measured using hand-held meters (YSI Professional Plus Multiparameter Water Quality Instrument 19E102487, YSI Incorporated, Brannum Lane Yellow Springs, Ohio, USA). COD, ammonium (NH4+), total nitrogen (TN) and total phosphorus (TP) were determined by the dichromate method, Nessler’s reagent spectrophotometry, ultraviolet spectrophotometry and ammonium molybdate spectrophotometric, respectively (State Environmental Protection Administration 2002). The samples were washed with sterile water several times to remove impurities. Voucher specimens were preserved in 4% formaldehyde. Voucher specimens were deposited in the Herbarium of Shanxi University (SXU), Shanxi University, Taiyuan, Shanxi Province, China (Voucher number: SXU-SX230328-31).

Figure 1.  

Map of the study area.

Morphological observations

Morphological characters of the specimens were observed under an Olympus BX-51 microscope (Olympus, Tokyo, Japan), equipped with a digital camera for photographing (DP72 Olympus, Tokyo, Japan).

DNA extraction, amplification and sequencing

Total DNA was extracted from the fresh thalli collected from Shanxi Province using a plant DNA extraction kit (Sangon Biotech, Shanghai, China). The four genes (SSU, LSU, ITS and rbcL) were amplified using the paired primers listed in Table 1. The polymerase chain reaction (PCR) amplifications were conducted in 50 μl volumes containing 37.75 μl ddH2O, 5.0 μl 10× buffer, 4.0 μl 2.5 mM dNTPs, 0.25 μl Taq DNA polymerase (Sangon Biotech, Shanghai, China), 1.0 μl of each primer (10 mM) and 1.0 μl of genomic DNA. The amplifications were performed using the following programmes: 94℃ for 5 min, 35 cycles of 94℃ for 30–60 s, 46.5–59℃ for 30–60 s and 72℃ for 2 min and final 72℃ for 10 min. The reaction was undertaken in a MyCycler thermal cycler (Bio-Rad, Hercules, CA, USA). The sequencing was performed on an ABI 3730XL sequencer. The DNA sequences generated in this study have been deposited in GenBank under accession numbers (OR230247, OR336050, OR284295 and PP025381).

Table 1.
Download as
CSV
XLSX

Primers for amplifying and sequencing of the nuclear SSU, LSU and rbcL rDNA.

Designation

Sequence (5’–3’)

Reference

SSU

16s

CCGAATTCGTCGACAACCTGGTTGATCCTGCCAGT

Medlin et al. (1988)

16f

CCCGGGATCCAAGCTTGATCCTTCTGCAGGTTCACCTAC

LSU

5.8SF

CGATGAAGAACGCAGCGAAATGCGAT

Riisberg et al. (2009)

LSU 4256R

GGAWTATGACTGAACGCCTCTAAGTCAGA

28S_25F

ACCCGCTGAATTTAAGCATATA

Jo et al. (2011)

28S_861R

GTTCGATTAGTCTTTCGCCCCT

28S_736F

CCCGAAAGATGGTGAACTC

28S_1440R

TGCTGTTCACATGGAACCTTTC

28S_1228F

CCTGAAAATGGATGGCGC

28S_2160R

CCGCGCTTGGTTGAATTC

28S_2038F

GACAAGGGGAATCCGACT

28S_2812R

GATAGGAAGAGCCGACATCGAA

rbcL

Chryso_rbcL_F4

TGGACDGAYTTATTAACDGC

Pusztai and Škaloud (2019)

Chryso_rbcL_R7

CCWCCACCRAAYTGTARWA

ITS

ITS4

TCCTCCGCTTATTGATATGC

White et al. (1990)

KN1.1

CAAGGTTTCCGTAGGTGAACC

Wee et al. (2001)

Sequence alignment and phylogenetic analysis

Newly-obtained sequences in this study and downloaded sequence data from GenBank (listed in Suppl. material 1) were aligned using MAFFT version 7 (Katoh et al. 2019). The sequences of SSU, LSU and rbcL were concatenated, based on the methods of Zhang et al. (2020). Pairwise genetic P-distances of concatenated sequences were calculated in MEGA 5.0 (Tamura et al. 2011). Synchroma grande and Nannochloropsis limnetica were used as outgroups in the phylogenetic tree. The appropriate model was built using the software PartitionFinder 2, with all algorithm and AIC criteria (for BI: Subset (1)(2)(3) = GTR + I + G; for ML: Subset (1)(2)(3) = GTR + I + G) (Lanfear et al. 2017). IQ-TREE was used to construct Maximum Likelihood (ML) trees with 5000 ultrafast bootstraps repetitions (Nguyen et al. 2015). Bayesian Inference (BI) phylogenies were inferred using MrBayes 3.2.6 and the BI analysis was run for 3,000,000 generations (Ronquist et al. 2012). The resulting phylogenetic trees were edited using FigTree 1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/). Adobe Illustrator CS5 (Adobe System, San Jose, CA, USA) was used to optimise the graphics of all trees.

Molecular clock analyses

We employed a Bayesian Inference method with a relaxed clock model using BEAST version 2.6.6 (Bouckaert et al. 2014) to conduct phylogeny and simultaneously estimate branch divergence times. We used the uncorrelated lognormal model to estimate variation rates across all branches. We used fossil calibrations as probabilistic priors. The lognormal priors were used for spits between the species Mallomonas denticulata and M. striata var. serrata and between M. elevata and M. foveata. Both calibrations were based on an offset of 38 Ma, a mean of 0.5 Ma and a standard deviation of 1.0, which represents a minimal age estimate for the majority of fossils of Mallomonas species from the Giraffe Pipe locality (Creaser et al. 2004, Doria et al. 2011, Siver et al. 2015). A generalised time reversible (GTR) + gamma site model was applied to the three-gene concatenated dataset and a Yule tree prior was used as a speciation model. The analysis was run for 50 million generations with the chain sampled every 1000 generations. Convergence of parameter estimates and estimation of burn-in was checked using the programme Tracer version 1.7 (Rambaut et al. 2018). The initial 5,000,000 (10%) were removed and the rest were retained to construct the final chronogram with 95% posterior probabilities (PP) and age estimates for all nodes. The resulting phylogenetic trees were edited using FigTree 1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/) and optimised using Adobe Illustrator CS5 (Adobe System, San Jose, CA, USA).

ITS2 secondary structures

The ITS2 sequences of the genera Mallomonas and Synura were downloaded from GenBank and aligned with the sequence of Hydrurus foetidus obtained in this study using MAFFT version 7 (Katoh et al. 2019). The ITS2 secondary structure of H. foetidus was constructed using the mfold computer programme (Zuker 2003) and VARNA (Darty et al. 2009).

Data resources

All the sequences in this study were retrieved from GenBank.

Taxon treatment

Hydrurus foetidus

Materials   Download as CSV 
  1. scientificName:
    Hydrurus foetidus
    ; locality:
    the Fenhe River, Shanxi Rrov., China
    ; verbatimElevation:
    1869.2 m
    ; verbatimCoordinates:
    38.8574 N 112.0831 E
    ; year:
    2023
    ; month:
    3
    ; catalogNumber:
    SXU-SX230328
    ; recordedBy:
    Liu En-Hui
    ; identifiedBy:
    Hao Jun-Xue
    ; type:
    specimen
    ; language:
    en
    ; collectionCode:
    Algae
    ; occurrenceID:
    B584ADE9-8946-54F2-B493-004E12833296
  2. scientificName:
    Hydrurus foetidus
    ; locality:
    the Fenhe River, Shanxi Rrov., China
    ; verbatimElevation:
    1506.89 m
    ; verbatimCoordinates:
    38.6605 N 112.1085 E
    ; year:
    2023
    ; month:
    3
    ; catalogNumber:
    SXU-SX230329
    ; recordedBy:
    Liu En-Hui
    ; identifiedBy:
    Hao Jun-Xue
    ; type:
    specimen
    ; language:
    en
    ; collectionCode:
    Algae
    ; occurrenceID:
    F1507A28-C087-5D3F-9053-42379E517331
  3. scientificName:
    Hydrurus foetidus
    ; locality:
    the Fenhe River, Shanxi Rrov., China
    ; verbatimElevation:
    1497.4 m
    ; verbatimCoordinates:
    38.5541 N 112.0191 E
    ; year:
    2023
    ; month:
    3
    ; catalogNumber:
    SXU-SX230330
    ; recordedBy:
    Liu En-Hui
    ; identifiedBy:
    Hao Jun-Xue
    ; type:
    specimen
    ; language:
    en
    ; collectionCode:
    Algae
    ; occurrenceID:
    860CA1A8-0FA5-58A3-B5BD-E9EDC98518C9
  4. scientificName:
    Hydrurus foetidus
    ; locality:
    the Fenhe River, Shanxi Rrov., China
    ; verbatimElevation:
    1356.05 m
    ; verbatimCoordinates:
    38.3588 N 111.9287 E
    ; year:
    2023
    ; month:
    3
    ; catalogNumber:
    SXU-SX230331
    ; recordedBy:
    Liu En-Hui
    ; identifiedBy:
    Hao Jun-Xue
    ; type:
    specimen
    ; language:
    en
    ; collectionCode:
    Algae
    ; occurrenceID:
    5677613E-26D2-51C6-A14B-4A62A0A4A514

Description

The morphological characters of the specimen are shown in Figs 2, 3. The Hydrurus thalli, ranging from green to dark brown, were securely attached to the surface of stones, see Fig. 2a and c. The thalli collected in Shanxi were approximately 5 cm in length. The thalli partially fragmented due to river erosion. Each thallus consisted of a firm central axis and peripheral branches, encased in a viscous gelatinous coating. Macroscopic views of the specimen are depicted in Fig. 2b and d and microscopic details of specimens in Shanxi are shown in Fig. 3.

Figure 2.  

Habitat and habitus of H. foetidus. a Habitat in the Fenhe River in March 2023; b Colony of H. foetidus collected from Shanxi growing on a stone surface, the dark green surface of the stone indicating colonies, shown by the arrow; c, d Macroscopic morphology of H. foetidus collected from Shanxi.

Figure 3.  

Morphological structures of Hydrurus foetidus collected from Shanxi, China observed by light microscope (LM). a, b arbuscular thalli of H. foetidus; c-e Larger magnifications of the distal part of thalli; f-h Intercalary cells of dense branches, cell division was happening in h; i free cells of loose branches and the polysaccharide sheath were visible; j, k Central axis cells; l newly-generated apical cells. Scare bars: a, b = 200 μm, c–l = 20 μm.

The dimensions of different cells of specimens in Shanxi were measured. The apical cells of branches, 6.00–17.14 μm × 4.52–13.57 μm, were half spheroid with flat or angular (Fig. 3c-e). The central axis cells were ellipsoid to ovoid and were 7.14–17.85 μm × 4.28–9.28 μm in size (Fig. 3j and k). The branch cells were 5.88–19.99 μm × 4.41–9.34 μm (Fig. 3f–i). The branch cells were further categorised into dense branching intercalary cells and loose branching free cells. The intercalary cells of the dense branches were ellipsoid with angular or compressed shapes, while the free cells of the loose branches were spherical to spheroid.

Distribution

The Fenhe River is the second largest tributary of the Yellow River, flowing through six cities in Shanxi Province. Hydrurus foetidus was collected in the Xinzhou section of this river. The physical and chemical parameters of water at four sites along the Fenhe River were recorded in Table 2 and the results revealed the following: the sites where H. foetidus was found ranged in altitude from 1356.05 to 1869.2 m, the water temperature ranged from 4.3℃ to 9.8℃, the pH ranged from 7.04 to 7.24. The lowest total dissolved solids content was 279.5 ppm, while the highest was 604.5 ppm. The dissolved oxygen concentration peaked at 15.22 mg/l, while the lowest was 12.27 mg/l. The electrical conductivity was lowest at 429.9 μS/cm, with other sites exhibiting values around 900 μS/cm. During our visit, the watercourse of the Fenhe River was observed to be between 70 and 200 cm deep. Notably, the Secchi depth of water at the source of the Fenhe River was 200 cm, significantly deeper than the 70–80 cm depths recorded at the other three sites. Total nitrogen levels ranged from 1.165 mg/l to 2.225 mg/l and total phosphorus levels were between 0.025 mg/l and 0.055 mg/l. COD varied between 41 mg/l and 50 mg/l and ammonium levels ranged from 0.35 mg/l to 0.47 mg/l.

Table 2.
Download as
CSV
XLSX

Specific information and physical and chemical properties of water on the localities of Hydrurus foetidus.

Site

The source of the Fenhe River

Kuaitunguan

Matou Mountain Village

Jingle Wetland Park

Coordinate [E]

112.0831

112.1085

112.0191

111.9287

Coordinate [N]

38.8574

38.6605

38.5541

38.3588

Altitude [m]

1869.2

1506.89

1497.4

1356.05

WT [℃]

9.8

4.4

6.3

4.3

pH

7.24

7.1

7.24

7.04

Salinity[ppt]

0.43

0.46

0.43

0.43

DO [mg/l]

12.27

15.22

14.09

14.68

TDS [ppm]

279.5

604.5

572

572

EC [μS/cm]

429.9

928

876

878

SD [cm]

200

80

80

70

TN [mg/l]

1.165

1.945

2.16

2.225

TP [mg/l]

0.025

0.05

0.055

0.05

COD [mg/l]

50

44

41

42

NH4+ [mg/l]

0.405

0.385

0.47

0.35

Analysis

Phylogenetic analysis

The molecular phylogeny was conducted, based on SSU, LSU and rbcL rDNA to reveal the placement of Hydrurus within Chrysophyceae. Pairwise distances, based on three genes, are respectively listed in Suppl. materials 2, 3, 4. The tree topologies, based on both methods including Maximum Likelihood and Bayesian Inference, were similar. Thus, only the BI trees containing all of the supporting values are shown in Fig. 4. In the phylogeny, two strains of the genus Hydrurus were grouped into a single clade, which was sister to Phaeoplaca thallosa with strong support (1.00/98). Within the monophyletic clade of Hydrurus, the specimen in this study clustered closely with H. foetidus collected from Norway supported by full values (1.00/100). Furthermore, the pairwise distance (0.0043) and base difference (21 bp) between the two H. foetidus strains underscored their genetic similarity. Additionally, phylogenetic relationships between Hydrurus and other genera of Chrysophyceae were also revealed. The clade of Paraphysomonadales diverged at the base of the phylogenetic tree (1.00/100). Within Synurales, the genus Neotessella was closely related to the genera Synura and Mallomonas (0.988/86). Lagynion was closely related to Chrysophaera and Chromophyton with high supporting values (1.00/100). Apoikia was clustered together with the genus Apoikiospumella (1.00/100). Within Chromulinales, Chrysamoeba was closely related to Oikomonas and Chromulina (1.00/100). Chrysosphaerella brevispina and C. longispina formed a sister group supported by high values (1.00/100). The genera Cyclonexis and Chromulinospumella diverged at the base of the clade of Chromulinales (0.982/98). Naegeliella and Chrysonebula were closely related to Kremastochrysopsis and Hibberdia (1.00/99). Segregatospumella dracosaxi formed an independent clade supported by low values (-/59). Ochromonas was not monophyletic, Ochromonas perlata and O. sphaerocystis were closely related to the genera Chlorochromonas and Cornospumella (1.00/100), while O. triangulata was closely related to species of Pedospumella and Uroglenopsis (1.00/99). The genus Spumella was monophyletic with a high supporting value (1.00/100). Urostipulosphaera was closely related to Acrispumella and Poteriospumella (0.998/97). The Dinobryon strains shared a close relationship with Kephyrion sp. and Melkoniana species. A high supporting value (1.00/99) indicated that Uroglena strains were strongly connected to Chrysonephele, Chrysolepidomonas and Epipyxis.

Figure 4.  

Bayesian Inference (BI) tree, based on concatenated SSU, LSU and rbcL rDNA sequences. Support values > 50% for all analyses are shown as follows: Bayesian posterior probabilities (BI)/Maximum Likelihood bootstrap values (ML). ‘-’ denotes < 50% support for that analysis at that node. Red boxes indicate the Hydrurus specimens collected from Shanxi Province, China.

Molecular clock analyses

Our estimates represent minimum ages primarily based on fossil remains from the Giraffe Pipe locality. Time-calibrated phylogenetic analysis estimated the origin of species within Chrysophyta (Fig. 5). Based on the Bayesian relaxed clock analyses, we estimated the origin of the genus Hydrurus to be in the Early Cretaceous, approximately 125 million years ago (Ma), with a likely range of 103.19 Ma to 148.86 Ma. The two Hydrurus foetidus strains, collected from China and Norway, diverged between 3.7 Ma and 9.7 Ma, most probably during the Neogene period. The clade of Ochromonadales diverged from Hibberdiales and Segregatales between the Early Jurassic and Late Triassic (174.94–220.8 Ma), most likely in the Early Jurassic. Apoikiida originated approximately 107.81 Ma and Chrysosaccales originated around 148.93 Ma. The clade of Chromulinales originated between 167.93 Ma and 213.69 Ma, most likely in the Early Jurassic. The clade encompassing Mallomonas and Synura diverged from Neotessella between the Early Cretaceous and Late Jurassic (119.13–151.79 Ma). Mallomonas diverged from Synura between 88.92 Ma and 111.91 Ma. Paraphysomonadales originated approximately in the Late Triassic (214.59 Ma).

Figure 5.  

Time-calibrated phylogenetic tree from a BEAST analysis of the three-gene dataset. Values at nodes represents the mean divergence time (in million of years). Blue bars represent the 95% confidence intervals. Red boxes indicate the Hydrurus specimens collected from Shanxi Province, China.

ITS2 secondary structures

The ITS1-5.8S rDNA-ITS2 region of Hydrurus foetidus was sequenced and the ITS2 secondary structure was constructed (Fig. 6). The ITS1 sequence length was 308 bp, the 5.8S sequence was 154 bp and the ITS2 sequence was 270 bp. Within the species of H. foetidus, a “ring-pin” model structure with four extended stems was identified. The ITS2 stems are typically maintained by base-pairing interactions amongst the four canonical Watson-Crick base pairs. The base and pairing composition of ITS2 in H. foetidus is shown in Table 3. In each division of ITS2, the paired region predominates over the unpaired region and the helix region is larger than the loop region. The bulge region, which was an unpaired portion of the helix region, occupies approximately a quarter of the total length (24.07%). Heterogeneity is presented in the base composition of ITS2. The base content reveals a hierarchy of A > U > C > G, with a high AU content accounting for 60.53% of the total bases, followed by GC content. A comparative analysis was conducted showing that helix I has a relatively lower purine content, being 0.88 times that of pyrimidine. In contrast, helices II–IV are dominated by purine.

Table 3.
Download as
CSV
XLSX

Base and pairing composition of ITS2 in Hydrurus foetidus.

A (%)

U (%)

C (%)

G (%)

Purines/

pyrimidines

CG(GC) (%)

AU(UA) (%)

GU(UG) (%)

Total

37.41

27.04

18.19

16.67

1.18

31.58

60.53

7.89

Paired region

55.77

42.95

26.28

25.64

1.18

31.58

60.53

7.89

Helix Ⅰ

33.33

30.00

23.33

13.33

0.88

33.33

66.67

0

Helix Ⅱ

47.50

30.00

7.50

15.00

1.67

21.43

71.43

7.14

Helix Ⅲ

36.17

27.66

17.02

19.15

1.24

29.41

52.94

17.65

Helix Ⅳ

34.75

27.97

19.49

17.80

1.11

36.36

57.58

6.06
Figure 6.  

ITS2 secondary structure of Hydrurus foetidus. Base numbering is indicated every 10 bases and the four helices are numbered with Roman numerals.

Discussion

Early reports suggested that the genus Hydrurus was widely distributed in the Holarctic Region, encompassing cold temperate inland localities (Ward 1994). A subsequent study by Klaveness (2019) narrowed down the distribution areas outside an approximate 40° N to 40° S belt around the equator. When studying the distributions of Hydrurus foetidus, we discovered confirmed occurrences in the Patagonian Andes of Challhuaco, South America and the Enguri River in Georgia (Villanueva et al. 2010, Barinova and Kukhaleishvili 2017). However, due to the lack of observed sightings, the latitude range of the distribution of H. foetidus remains uncertain. Apparent exceptions to the distribution limits include a high-mountain location in east Turkey at 39°44′ N (Cevik et al. 2007), an outflow from the Lirung glacier in Nepal (Hirano 1969), a high mountain in Tibet, China (Raju and Suxena 1979), the Vakhsh River Basin lakes (Barinova et al. 2015) and the Pamir aquatic habitats (Barinova and Niyatbekov 2018). In this study, H. foetidus thalli was collected from Shanxi Province, China, at about 38° N, which is included in the distribution of that proposed by Klaveness (2019). Additionally, the effect of altitude on distribution should not be ignored; the species H. foetidus prefers freshwater habitats located at higher altitudes (Mašić et al. 2020). In addition, the four sites of Hydrurus specimens collected in this study were all near the source of the Fenhe River, aligning with earlier reports indicating a preference for Hydrurus to inhabit the source of rivers (Klaveness 2019). Consequently, we suggest expanding the latitude range of the distribution of the genus Hydrurus and emphasising the need to further explore the geographical diversity of this genus.

H. foetidus is an important indicator of clean water and good ecological status (Klaveness 2017). The species preferentially inhabits fast-flowing waters with low temperatures, exhibiting both rheophilic and psychrophilic properties (Klaveness 2017, Klaveness 2019). Several studies have revealed that the highest water temperature in the distributions of Hydrurus does not exceed 16℃, maintaining a pH range of 7.5–8.3 and an oxygen content range of 10.6–15.1 mg/l (Bursa 1934, Redžić 1988, Krizmanić et al. 2008, Stanković and Leitner 2016). In our study, the water temperature ranged from 4.4℃ to 6.3℃, with a pH of 7.04–7.24 and oxygen of 14.09–15.22 mg/l. We find certain similarities in the ecological characteristics of various habitats, particularly regarding water temperature, pH and oxygen levels. Our results support the reported ranges for water temperature and oxygen levels while expanding the pH range. Hydrurus is sensitive to temperature and other chemical properties. Therefore, H. foetidus prefers freshwater habitats characterised by clean, cold, flowing water sources such as springs, streams, lakes and rivers. In addition, the growth of Hydrurus exhibits certain seasonality. Typically, H. foetidus survives primarily from autumn to the subsequent spring, disintegrates and disappears in summer and re-appears in early autumn. Our specimen was collected in early spring. However, we rarely discover the species in winter, possibly due to environmental factors beyond temperature.

Each thallus of H. foetidus is arbuscular, composed of central axes and branches. The length of thalli can reach or exceed 30 cm under favourable conditions (Bursa 1934). The detailed morphological characteristics of this species have been described and previous studies have provided cell size of H. foetidus: 8–16 × 12–22 μm (Mack 1953); 7–20 μm (Joyon 1963); 5–15 μm (Vesk et al. 1984). Klaveness and Lindstrøm (2011) separated measurements of the different cell categories, including apical cells (9–16 × 12–19 μm), central axis cells (20–32 × 8–12 μm) and branch cells (9–17.5 × 10–18 μm). In this study, we measured the cell size of the wild Hydrurus thalli collected from Shanxi Province. The cell size in this study was smaller than those reported in 2011, possibly due to variations in growth conditions between wild and cultured algal strains. In addition, the species exhibits obvious phenotypic plasticity and the taxonomic history of the genus Hydrurus is complex and uncertain; therefore, relying only on morphological characteristics to study the species diversity is not sufficiently accurate.

However, the molecular sequences of the genus Hydrurus are scarce. Previous studies only provided three sequences and conducted phylogenetic trees to safely confirm Hydrurus as a chrysophyte (Lim et al. 1986, Klaveness et al. 2011). The absence of additional sequences of the genus Hydrurus underscores the need for more comprehensive molecular information to further determine the phylogenetic placement of the genus Hydrurus lineage. In our study, only the molecular sequences from the Shanxi specimen were obtained. We provided the first rbcL and ITS sequences for H. foetidus and predicted the ITS2 secondary structure of H. foetidus. Furthermore, phylogenetic trees were conducted, based on concatenated SSU, LSU and rbcL sequences to clarify the taxonomic status of H. foetidus. The close relationship between Hydrurus species collected in Shanxi, China and Norway was inferred. The results of this study complement molecular evidence for the genus Hydrurus and enhance our comprehension of the species diversity of chrysophyta.

Molecular clock analysis is rarely employed in the genus Hydrurus. Čertnerová et al. (2019) briefly alluded to the origin of the genus Hydrurus in their evolutionary study of Mallomonas. Based on our relaxed clock analysis, the genus Hydrurus originated in the Early Cretaceous (approximately 125 Ma). The estimate is closer to the 130 Ma origin deduced by Čertnerová et al. (2019). In addition, our estimated diversifications of Synurales are slightly younger compared to the analyses presented by Siver and Čertnerová et al. (Siver et al. 2015, Čertnerová et al. 2019). Our time-calibrated phylogenetic analysis offers a valuable reference for the evolutionary history of Chrysophyta. Of course, more fossil discoveries and their application to the study of the evolutionary history of chrysophyta are crucial for further advancements.

New geographical distribution of the genus Hydrurus was discovered in the Fenhe River, Shanxi, China. Both morphological characteristics and molecular phylogeny strongly supported the new record of Hydrurus foetidus in China. This species exhibited temperature sensitivity and displayed distinct seasonal variations. The visible thallus consisted of a firm central axis and peripheral branches, with varying cell shapes. The phylogenetic analysis revealed a close relationship between H. foetidus specimens from China and Norway. Furthermore, the time-calibrated phylogenetic analysis inferred that the genus Hydrurus originated most likely in the Early Cretaceous. This study supplements new molecular evidence of H. foetidus, enriching our knowledge of the species diversity and evolutionary history of the genus Hydrurus.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No. 32270220 and U22A20445 to Jia Feng) and the Nature Science Foundation of Shanxi Province (No. 202203021211313). We thank Enhui Liu for physical assistance in the process of collecting samples and Professor John Patrick Kociolek (University of Colorado) for his suggestions on this manuscript.

Author contributions

Conceptualisation, Junxue Hao and Jia Feng; methodology, Junxue Hao and Yalu An; software, Fangru Nan and Xudong Liu; formal analysis, Junxue Hao and Yalu An; investigation, Junxue Hao; resources, Junping Lv and Qi Liu; data curation, Junxue Hao; writing-original draft preparation, Junxue Hao; writing—review and editing, Jia Feng; visualisation, Shulian Xie; funding acquisition, Jia Feng. All authors have read and agreed to the published version of the manuscript.

References

Supplementary materials

Suppl. material 1: Table S1 
Authors:  Junxue Hao, Yalu An, Fangru Nan, Junping Lv, Qi Liu, Xudong Liu, Shulian Xie and Jia Feng
Data type:  Table
Brief description: 

Taxa and accession numbers used in this study. Newly-acquired strain is highlighted in bold.

Download file (15.27 kb)
Suppl. material 2: Table S2 
Authors:  Junxue Hao, Yalu An, Fangru Nan, Junping Lv, Qi Liu, Xudong Liu, Shulian Xie and Jia Feng
Data type:  Table
Brief description: 

Pairwise distance (lower-left matrix) and number of nucleotide variance (upper-right matrix) of SSU sequence amongst the taxa in this study.

Download file (108.00 kb)
Suppl. material 3: Table S3 
Authors:  Junxue Hao, Yalu An, Fangru Nan, Junping Lv, Qi Liu, Xudong Liu, Shulian Xie and Jia Feng
Data type:  Table
Brief description: 

Pairwise distance (lower-left matrix) and number of nucleotide variance (upper-right matrix) of LSU sequence amongst the taxa in this study.

Download file (49.00 kb)
Suppl. material 4: Table S4 
Authors:  Junxue Hao, Yalu An, Fangru Nan, Junping Lv, Qi Liu, Xudong Liu, Shulian Xie and Jia Feng
Data type:  Table
Brief description: 

Pairwise distance (lower-left matrix) and number of nucleotide variance (upper-right matrix) of rbcL sequence amongst the taxa in this study.

Download file (83.50 kb)
login to comment