Biodiversity Data Journal :
Taxonomy & Inventories
|
Corresponding author: Feng Zhang (dudu06042001@163.com)
Academic editor: Jeremy Miller
Received: 25 Sep 2024 | Accepted: 23 Dec 2024 | Published: 02 Jan 2025
© 2025 Long Hao, Kun Yu, Feng Zhang
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Hao L, Yu K, Zhang F (2025) Description of five new species from southern China, with note on the type species of Latouchia Pocock, 1901 (Araneae, Halonoproctidae). Biodiversity Data Journal 13: e137852. https://doi.org/10.3897/BDJ.12.e137852
|
|
The genus Latouchia Pocock, 1901 previously included 25 known species and one subspecies from Asia, 12 species and one subspecies were reported in China.
Five new species of Latouchia Pocock, 1901 from southern China are described: L. calcicola sp. nov. (♂♀) from Hainan, L. jinyun sp. nov. (♂♀) from Chongqing, L. linmufu sp. nov. (♂♀) from Hunan, L. wenchuan sp. nov. (♂) from Sichuan and L. yaoi sp. nov. (♂♀) from south part of Shaanxi. DNA barcodes of the new species described herein are provided. The potential error in the previous illustrations of the alleged male of L. fossoria Pocock, 1901 (type species of the genus) is pointed out.
Species diversity, embolus, new species, taxonomy, trapdoor spider
The genus Latouchia Pocock, 1901, represents one of the Asian lineages within the family Halonoproctidae Pocock, 1901, forming the subfamily Ummidiinae Ortiz, 2007 alongside the Asian/Australasian genus Conothele Thorell, 1878 and the widespread genus Ummidia Thorell, 1875 (
China stands out as one of the main distribution areas known for Latouchia. In the 25 known species and one subspecies within the genus, half (12 species and one subspecies) were reported in China (
All specimens preserved in 75%–100% ethanol were examined under a Leica M205A stereomicroscope. The photographs of genitalia were taken by an Olympus BX53 microscope equipped with a Kuy Nice CCD Camera; the photographs of habitus were taken by a SONY Alpha 7R Camera. Photographs of specimens were stacked by the Helicon Focus 8 software and retouched in the Adobe Photoshop CC ©2021 software. Specimens were measured by the measuring tool of Leica LAS V. 4.3 software. All measurements are given in millimetres. Total length of body excludes chelicerae. Spination shown as location (number and arrangement of spines on left leg/right leg), from proximal to distal. The measurements of palps are shown as: total length (femur, patella, tibia, tarsus) (male palpal tarsus measured cymbium only); the measurements of legs are shown as: total length (femur, patella, tibia, metatarsus, tarsus); leg formulae are given as: longest to shortest. Female vulvae were cleared with Pancreatin (BBI Life Sciences). All specimens studied are deposited in the Museum of Hebei University (MHBU), Baoding, China.
Abbreviations used in this study: A, apical keel; AE, apex of embolus; ALE, anterior lateral eye; AME, anterior median eye; BE, base of embolus; d, dorsal; dK, dorsal keel; Dpd, distal of prodorsal side; Dpv, distal of proventral side; Drd, distal of retrodorsal side; Drv, distal of retroventral side; K, keel; MOA, median ocular area; Mp, middle of prolateral side; Mpd, middle of prodorsal side; Mpv, middle of proventral side; Mr, middle of retrolateral side; Mrv, middle of retroventral side; Mv, middle of ventral side; pd, prodorsal; pl, prolateral; PLE, posterior lateral eye; PME, posterior median eye; PS, prolateral superior keel on tip of embolus; Pv, proximal of ventral side; pv, proventral; rd, retrodorsal; rl, retrolateral; RS, retrolateral superior keel on tip of embolus; rv, retroventral; v, ventral; SK, stalk; SR, sperm receptacle; ST, subtegulum; T, tegulum.
Generic synonyms
Kishinouyeus
Cronebergella
See
China, India, Vietnam, Japan, Thailand, Uzbekistan (?).
Cronebergella Charitonov, 1946 was considered as junior synonym of either Latouchia or Sterrhochrotus Simon, 1892 in two separate publications in 1985 (see
Schenkel (
Male (Holotype, MHBU-ARA-10000046). Colouration in ethanol (Fig.
Latouchia calcicola sp. nov. A–C, E–F Male; D, G Female. A, C Palpal bulb; B Distal half of embolus, with arrow indicates the small ridge near the apex of embolus; D Vulva; E Patella and tibia of left leg II, showing the spination; F Band of spinules on coxa III; G Claw of left leg I. In retrolateral (A), prolateral (E, G), dorsal (D), ventral (B, C) and ventro-posterior (F) view. Abbreviations: DH, distal haematodocha; E, embolus; K, keel; SR, sperm receptacle; ST–subtegulum; SK–stalk; T–tegulum.
Latouchia jinyun sp. nov. A, C, E–H Holotype male; B, D, I Paratype female. A–D Habitus; E, F Palp; G Palpal bulb; H Distal half of embolus; I Vulva, with arrows indicate stalk tilts approximately 45° towards the body axis. In dorsal (A, B, I), ventral (C–E), prolateral (G, H) and retrolateral (F) view.
Latouchia jinyun sp. nov. A, B, D, F Male; C, E. Female. A Palpal bulb; B Distal part of embolus; C Vulva; D Patella and tibia of left leg II, showing the spination; E, F Paired claws of left leg I. In prolateral (A, B, D, E, F) and dorsal (C) view. Abbreviations: A, apical keel; AE, apex of embolus; BE, base of embolus; PS, prolateral superior keel on tip of embolus; RS, retrolateral superior keel on tip of embolus; SR–sperm receptacle; ST–subtegulum; SK–stalk; T–tegulum.
Latouchia linmufu sp. nov. A–C, E, F Holotype male; D, G Paratype female. A, B Bulb; C Apex of embolus; D Vulva; E Patella and tibia of left leg II, showing the spination; F, G Paired claws of left leg I. In prolateral (B, C, E), retrolateral (A, F, G) and dorsal (D) view. Abbreviations: AE, apex of embolus; BE, base of embolus; DH, distal haematodocha; SR–sperm receptacle; ST–subtegulum; SK–stalk; T–tegulum.
Latouchia wenchuan sp. nov., holotype male. A, B Palpal bulb; C Embolus; D Apex of embolus; E Claw of left leg I; F Patella and tibia of left leg II, showing the spination. In prolateral (F), retrolateral (B, C, E) and dorsal (A, D) view. Abbreviations: AE, apex of embolus; BE, base of embolus; DH, distal haematodocha; K–keel; ST–subtegulum; T–tegulum.
Latouchia yaoi sp. nov. A–D, F Male; E, G Female. A, B Palpal bulb; C Apex of embolus; D Patella and tibia of left leg II, showing the spination; E Vulva; F, G Paired claws of left leg I. In prolateral (A, C, D), retrolateral (B, F, G) and dorsal (E) view. Abbreviations: DH, distal haematodocha; E–embolus; K–keel; SR–sperm receptacle; ST–subtegulum; SK–stalk; T–tegulum.
Total length 11.23. Carapace 5.31 long, 4.55 wide; opisthosoma 5.92 long, 5.12 wide. Eye group 0.55 long, 0.44 wide anteriorly, 0.71 wide posteriorly; MOA 0.47 long, front width 0.36, back width 0.53. Eye diameters and interdistance: AME 0.15, ALE 0.28, PME 0.22, PLE 0.27, AME–AME 0.15, AME–ALE 0.11, ALE–PLE 0.12, PME–PME 0.32, PME–PLE 0.05. Palpal coxa 1.65 long, 1.04 wide, bearing 12/13 spinules and 4/2 basally thickened bristles on prolateral-proximal corner. Sternum 3.10 long, 2.53 wide. Labium 0.66 long, 0.93 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying seven and six stout spines, respectively; chelicerae groove with 7/7 and 6/6 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 15.29 (4.94, 2.13, 3.50, 3.10, 1.62), II 13.14 (4.09, 1.70, 3.01, 2.64, 1.70), III 11.25 (2.98, 1.51, 1.82, 3.16, 1.78), IV 15.53 (4.88, 2.09, 3.97, 2.58, 2.01). Spines on femora to metatarsi of legs I–II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, both ventrally with few typical; spines on prolateral tibiae of legs I–II typical, but fewer on leg I than II, ventrally typical and expansive on both legs (Fig.
Spines on legs I–II of different males. In prolateral (a–f) view:
Palp 8.00 long (3.19, 1.48, 2.65, 0.68). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, the former sparsely distributed at distal end of trichobothrial area, while the latter occupies majority of trichobothrial area; count of trichobothria: Tibia 3/3d, cymbium 3/4 unmodified and 8/9 clavate. Tibia slender, moderately uniform in thickness (Fig.
Female (Paratype, MHBU-ARA-10000047). Colouration in ethanol (Fig.
Total length 12.95. Carapace 5.13 long, 4.02 wide; opisthosoma 8.93 long, 5.26 wide. Eye group 0.67 long, 0.41 wide anteriorly, 0.66 wide posteriorly; MOA 0.51 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.13, ALE 0.32, PME 0.24, PLE 0.31, AME–AME 0.12, AME–ALE 0.07, ALE–PLE 0.10, PME– PME 0.25, PME–PLE 0.04. MOA 0.51 long, front width 0.25, back width 0.41. Palpal coxa 2.07 long, 1.17 wide, bearing 20/18 cuspules and 0/1 basally thickened bristle on prolateral-proximal corner. Sternum 3.50 long, 3.17 wide. Labium 1.07 long, 0.90 wide, with two spinules, without cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carries 10 and nine stout spines, respectively; chelicerae groove with 5/8 and 7/7 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 9.11 (3.46, 1.77, 2.05, 1.05, 0.78), II 8.04 (3.03, 1.57, 1.58, 1.06, 0.80), III 6.22 (1.73, 0.97, 1.01, 1.38, 1.13), IV 11.38 (3.47, 1.93, 2.57, 1.99, 1.42). Spines of legs I–II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Trichobothria of legs present on proximal one-third part of tibiae I–III, proximal one-fourth part of tibia IV, distal half of metatarsi I–IV and proximal two-thirds of all tarsi; trichobothria on tibiae I–IV and metatarsi I–IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with latter only present in proximal half of tarsus. Count of trichobothria on legs: I, tibia 5/5pd and 5/5rd, metatarsus 10/10, tarsus 15/12 unmodified and 11/7 clavate; II, tibia 5/5pd and 5/4rd, metatarsus 11/9, tarsus 11/12 unmodified and 6/7 clavate; III, tibia 4/4pd and 4/4rd, metatarsus 10/12, tarsus 15/11 unmodified and 1/3 clavate; IV, tibia 6/5pd and 5/5rd, metatarsus 8/8, tarsus 12/9 unmodified and ?/3 clavate. Coxae I–III bear band of spinules on ventro-posterior area. Tarsal claws: all paired claws with one tooth (Fig.
Vulva (Fig.
The male of new species morphologically resembles those of the adjacent mainland (Guandong) species Latouchia rufa Zhang & Wang, 2021 in the distinct distal elevation of the dorsal keel of the embolus (dK), forming a lamellar structure; however, it can be distinguished from L. rufa as here the dK extends across the proximal two-thirds of the embolus and the length of embolus is approximately 1.3 times the width of bulb (Fig.
The specific epithet is Latin, meaning “limestone-dweller”; noun in apposition.
Known only from the type locality of Hainan, China (Fig.
The type localities of Latouchia species of China: L. calcicola sp. nov. (1), L. jinyun sp. nov. (2), L. linmufu sp. nov. (3), L. wenchuan sp. nov. (4), L. yaoi sp. nov. (5), L. cornuta (6), L. wenruni (7), L. yuanjingae (8), L. hunanensis (9), L. rufa (10), L. formosensis (11), L. formosensis smithi (12), L. yejiei (13), L. davidi (14), L. fossoria (15) and L. pavlovi (16). The type locality of L. vinhiensis is uncertain.
This newly discovered species constructs burrows in the crevices amongst rocks in the limestone cave of the type locality (Fig.
AATCATAAAGATATTGGAACTTTATATATAGTGTTAGGGGTATGGTCCGCTATATTGGGTACAGGGATAAGAGTAATAATTCGGATGGAATTAGGACAGGTTGGTAGATTGATTGGAGATGATCATTTGTATAATGTTATTGTTACTGCTCACGCTCTTGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGGGGATTTGGAAATTGGCTATTGCCTTTGATATTGGGGAGTCCGGATATAGCTTTTCCACGTATGAATAATTTGAGTTTTTGATTATTGCCTCCTTCATTGATGATGTTTTTGATTTCTTCTTTAATTGATACGGGGGTTGGAGCGGGATGGACTATTTATCCTCCTTTGTCTTCTTGTTTGGGGCATAGAGGTGGGGGGATAGATTTTGTTATTTTTTCATTGCATCTAGCAGGGGCTTCTTCAATTATGGGAGCGGTGAATTTTATTTCTACTGTTATGAACATACGTCCTCAGGGAATGAAAATAGAACGGGTTCCTTTGTTTGTGTGATCTGTGTTAATTACGACTATTTTATTATTGTTGTCTTTACCAGTATTGGCGGGGGCAATTACGATATTATTAACTGATCGAAATTTTAATACCTCGTTTTTTGATCCGGCTGGGGGGGGGGATCCGGTGTTGTTTCAACATTTATTTTGATTTTTTGGTCACCC (GenBank accession number: PQ585635).
Latouchia fossoria
Known only from the type locality of Fujian, China (Fig.
The L. fossoria Pocock, 1901 was originally described, based on a female specimen collected from Kuatun (117.64°E, 27.73°N) in Fujian Province, China. The original illustrations of this species consisted solely of the female's ocular area and sternum (
Male (Holotype, MHBU-ARA-10000049). Colouration in ethanol (Fig.
Total length 11.15. Carapace 5.06 long, 4.78 wide; opisthosoma 6.07 long, 3.98 wide. Eye group 0.61 long, 0.44 wide anteriorly, 0.67 wide posteriorly; MOA 0.42 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.12, ALE 0.30, PME 0.13, PLE 0.25, AME–AME 0.12, AME–ALE 0.14, ALE–PLE 0.15, PME–PME 0.29, PME–PLE 0.03. Palpal coxa 1.72 long, 0.91 wide, without spinule on prolateral-proximal corner. Sternum 3.03 long, 2.75 wide. Labium 0.56 long, 0.99 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carries 10 and nine stout spines, respectively; chelicerae groove with 5/4 and 3/3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 12.71 (2.46, 2.11, 3.30, 3.02, 1.82), II 11.36 (2.45, 1.94, 2.61, 2.80, 1.56), III 11.22 (3.34, 1.37, 1.69, 2.68, 2.14), IV 14.74 (4.18, 2.03, 3.46, 3.26, 1.81). Spines on femora to metatarsi of legs I–II straight, sword-like (typical); strong spines on the prolateral patellae of leg II, none on leg I, both ventrally with few typical; spines on prolateral tibiae of legs I–II often short, straight, mostly with hooked tip, much more numerous and stouter on leg II than leg I, ventrally more elongate on both legs, either straight or slightly curved (Fig.
Palp 6.48 long (2.41, 1.20, 1.97, 0.90). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 3/3pd, 3/3rd, cymbium 5/4 unmodified and 4/6 clavate. Tibia tubby, slightly diminution from proximal to distal, with one lyriform organ on ventro-prolateral side of sub-distal part; tibia lacks spine or spinule (Fig.
Female (Paratype, MHBU-ARA-10000050). Colouration in ethanol (Fig.
Total length 12.97. Carapace 5.53 long, 4.43 wide; opisthosoma 7.43 long, 4.81 wide. Eye group 0.54 long, 0.46 wide anteriorly, 0.60 wide posteriorly; MOA 0.51 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.15, ALE 0.29, PME 0.15, PLE 0.25, AME–AME 0.12, AME–ALE 0.05, ALE–PLE 0.10, PME– PME 0.29, PME–PLE 0.03, MOA 0.43 long, front width 0.21, back width 0.41. Palpal coxa 1.93 long, 1.23 wide, bearing 44/39 cuspules on prolateral-proximal corner. Sternum 3.09 long, 2.83 wide. Labium 0.76 long, 1.16 wide, with two spinules and one cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying 11 and nine stout spines, respectively; chelicerae groove with 5/5 and 3/3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 8.95 (3.25, 1.22, 2.19, 1.27, 1.02), II 8.57 (3.00, 1.57, 1.69, 1.27, 1.04), III 7.54 (2.73, 1.12, 0.93, 1.42, 1.34), IV 15.53 (3.67, 1.58, 2.39, 1.98, 1.74). Spines of legs I–II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III strong; tibia III shortened, without demi-saddle shape. Groups of short spines on apical and prodorsal sides of patella and dorso-lateral side of tibia; metatarsus with spines grouped in dorso-lateral area. Patella with dorso-proximal group of short stiff bristles on leg IV. Trichobothria of legs present on proximal one-third part of tibiae I–IV, distal half of metatarsi I–IV and proximal two-thirds of all tarsi; trichobothria on tibiae I–IV and metatarsi I–IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with latter only present in proximal half of tarsus. Count of trichobothria on legs: I, tibia 4/4pd and 5/4rd, metatarsus 7/5, tarsus 10/11 unmodified and 6/6 clavate; II, tibia 5/5pd and 5/5rd, metatarsus 7/7, tarsus 10/10 unmodified and 5/6 clavate; III, tibia 5/5pd and 5/6rd, metatarsus 7/6, tarsus 9/10 unmodified and 2/4 clavate; IV, tibia 7/5pd and 5/6rd, metatarsus 7/7, tarsus 9/7 unmodified and 1/2 clavate. Tarsal claws: all paired claws with one tooth (Fig.
Vulva (Fig.
The new species can be easily distinguished from the congeners by the following features: in the males, the distal one-third portion of the embolus is obviously bent, forming a hook-shaped structure (Fig.
The specific epithet is derived from the type locality; noun in apposition.
Known only from the type locality of Chongqing, China (Fig.
The burrows of L. jinyun sp. nov. are commonly found on slopes covered with moss along roadsides. The trapdoor is typically composed of a mixture of moss, mud and silk, with few cases of other materials. During a survey conducted in January 2016, many males were found to be overwintering within their burrows, which were covered with trapdoors indistinguishable from those of female.
AAAGATATTGGAACATTGTATTTAGTTTTTGGGGTGTGATCTGCGATATTAGGAACTGGAATAAGAGTAATTATTCGAACTGAGTTGGGGCAGGTGGGGAGAATATTGGGGGATGATCATTTGTATAACGTAATTGTAACTGCTCATGCTCTTGTTATAATCTTTTTTATAGTTATACCTATTATGATTGGGGGATTTGGAAACTGACTACTACCTTTGATATTAGGAGCGCCTGATATAGCATTTCCTCGAATGAATAATTTAAGATTTTGATTGTTACCTCCTTCTTTGTTTATATTGCTTTTGTCTTCATTAGTGGATACTGGGGTTGGAGCAGGTTGGACTATTTATCCGCCTTTATCTTCAGGATTAGGGCATAGAGGTGGAGGAATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCGTCGATTATAGGTTCTATTAATTTTATTTCTACTATTACTAATATGCGTTCTAATGGAATGGATATAGGGCGTGTGCCTTTATTTGTATGGTCTGTGTTAATTACTACTATTTTATTATTATTATCTTTACCCGTTTTGGCTGGAGCTATCACCATATTATTGACAGATCGGAATTTTAATACTTCATTTTTTGACCCTGCGGGGGGTGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTTTGGTCAC (GenBank accession number: PQ585639).
Male (Holotype, MHBU-ARA-10000052). Colouration in ethanol (Fig.
Total length 8.97. Carapace 4.68 long, 4.50 wide; opisthosoma 4.25 long, 2.40 wide. Eye group 0.49 long, 0.72 wide anteriorly, 0.74 wide posteriorly; MOA 0.35 long, front width 0.37, back width 0.49. Eye diameters and interdistance: AME 0.14, ALE 0.24, PME 0.10, PLE 0.24, AME–AME 0.08, AME–ALE 0.05, ALE–PLE 0.08, PME–PME 0.28, PME–PLE 0.04. Palpal coxa 1.52 long, 0.94 wide, bearing 9/9 spinules on prolateral-proximal corner. Sternum 2.46 long, 2.35 wide. Labium 0.70 long, 0.81 wide, with one spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and four stout spines, respectively; chelicerae groove with 7/5 and 5/4 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 14.29 (4.72, 1.70, 3.43, 2.95, 1.49), II 11.86 (3.75, 1.16, 2.81, 2.41, 1.73), III 11.55 (3.41, 1.37, 2.01, 2.91, 1.85), IV 16.99 (5.21, 1.73, 3.71, 3.88, 2.46). Spines on femora to metatarsi of legs I–II straight, sword-like (typical); strong spines on the prolateral patellae of leg I and II, ventrally few typical or absent; spines on prolateral tibiae of legs I–II relatively short, more numerous and stouter on leg II, ventrally more elongate on both legs, three especially elongate spines medially on leg II (Fig.
Palp 5.39 long (1.76, 1.11, 1.63, 0.89). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 3/2pd, 3/3rd, cymbium 3/4 unmodified and 4/3 clavate. Tibia cylindrical, proximal one-third of tibia widest and slightly narrowing to distal, with one lyriform organ on ventro-prolateral side of sub-distal part (Fig.
Female (Paratype, MHBU-ARA-10000053). Colouration in ethanol (Fig.
Total length 9.89. Carapace 4.88 long, 4.24 wide; opisthosoma 4.99 long, 3.34 wide. Eye group 0.44 long, 0.64 wide anteriorly, 0.68 wide posteriorly; MOA 0.34 long, front width 0.37, back width 0.56. Eye diameters and interdistance: AME 0.14, ALE 0.25, PME 0.12, PLE 0.22, AME–AME 0.09, AME–ALE 0.09, ALE–PLE 0.10, PME– PME 0.31, PME–PLE 0.03. Palpal coxa 1.21 long, 0.77 wide, bearing 13/12 cuspules on prolateral-proximal corner. Sternum 2.59 long, 2.74 wide. Labium 0.72 long, 0.88 wide, without spinule or cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying 10 and eight stout spines, respectively; chelicerae groove with 5/5 and 5/5 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 8.51 (3.04, 1.92, 1.66, 1.11, 0.78), II 7.75 (2.74, 1.65, 1.312, 1.15, 0.89), III 7.00 (2.30, 1.49, 1.14, 1.22, 0.85), IV 10.50 (3.75, 1.47, 1.99, 1.75, 1.54). Spines of legs I–II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III–IV with tarsus carrying a distal ventral of short stiff bristles. Slender spines on dorso-distal and ventral side of metatarsus III–IV. Tibia III significantly shortened, without demi-saddle shape, groups of short strong spines on dorso-lateral side of tibia and on apical and prodorsal sides of patella III; patella IV with dorso-proximal group of short stiff bristles and few short spines. Trichobothria of legs present on proximal one-third part of tibiae I–IV, distal half of metatarsi I–IV and proximal two-thirds of all tarsi; trichobothria on tibiae I–IV and metatarsi I–IV unmodified; trichobothria on tarsi I–III divided into unmodified and clavate forms, with latter only present in proximal half of tarsus,trichobothria on tarsi IV unmodified. Count of trichobothria on legs: I, tibia 4/4pd and 3/4rd, metatarsus 7/6, tarsus 11/10 unmodified and 3/3 clavate; II, tibia 4/4pd and 4/4rd, metatarsus 7/5, tarsus 10/12 unmodified and 3/1 clavate; III, tibia 3/4pd and 4/4rd, metatarsus 6/7, tarsus 9/12 unmodified and 1/3 clavate; IV, tibia 6/5pd and 5/5rd, metatarsus 5/6, tarsus 8/9 unmodified. Tarsal claws: all paired claws with two teeth on common base (Fig.
Vulva (Fig.
The male of the new species can be distinguished from congeners by the relatively straight and needle-like embolus (Fig.
The specific epithet is a combination of the family name of the collector (Lin) and the type locality (Mufu Mountain); noun in apposition.
Known only from the type locality of Hunan, China (Fig.
GGAAGATTGTTTGGGGATGATCATTTGTATAATGTAATTGTGACTGCACATGCTCTTGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGCGGTTTTGGCAATTGGTTGTTGCCTATAATGATTGGGGCTCCTGATATGGCATTTCCTCGAATAAATAATTTTAGATTTTGGTTGTTACCTCCTTCTTTGTTTTTGCTTTTGCTGTCTTCTCTAGTGGGTGAGGGGGTTGGAGCAGGGTGAACTATTTATCCTCCCTTGTCTTCGGGGATGGGACATAGAGGAGGGGGTGTGGATTTTGCTATTTTTTCTTTGCATTTAGCGGGGGCGTCCTCAATTATGGGGTCGATTAATTTTATTTCTACTATTATTAATATGCGGGCTAGGGGGATGGATATGGAGAGGGTGCCTTTGTTTGTGTGGTCAGTGTTAATTACTACAGTGTTGCTTTTGTTGTCCTTGCCGGTTCTGGCAGGGGCTATTACGATGTTGTTGACTGATCGTAATTTTAATACTTCGTT (GenBank accession number: PQ585638).
Male (Holotype, MHBU-ARA-10000055). Colouration in ethanol (Fig.
Total length 9.22. Carapace 5.03 long, 4.31 wide; opisthosoma 4.17 long, 2.85 wide. Eye group 0.50 long, 0.45 wide anteriorly, 0.68 wide posteriorly; MOA 0.33 long, front width 0.22, back width 0.38. Eye diameters and interdistance: AME 0.11, ALE 0.25, PME 0.15, PLE 0.19, AME–AME 0.14, AME–ALE 0.12, ALE–PLE 0.13, PME–PME 0.30, PME–PLE 0.07. Palpal coxa 1.51 long, 0.81 wide, bearing 18/16 spinules on prolateral-proximal corner. Sternum 3.23 long, 2.46 wide. Labium 0.52 long, 0.87 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying five and four stout spines, respectively; chelicerae groove with 4/4 and 3/3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 15.75 (4.84, 2.29, 3.77, 3.21, 1.64), II 12.29 (3.42, 1.94, 2.94, 2.68, 1.31), III 11.60 (3.33, 1.26, 2.05, 2.93, 2.03), IV 16.19 (4.61, 1.49, 3.57, 4.34, 2.18). Spines on femora to metatarsi of legs I–II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, ventrally strong on leg I (especially distally), tip hooked, but absent on leg II; spines on prolateral tibiae several typical, less numerous on leg II, ventrally more elongate, two especially elongate adjacent spines proximally on leg II (Fig.
Palp 6.62 long (2.81, 0.99, 2.05, 0.77). Trichobothria on palpal tibia unmodified, present on proximal half part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 1/3pd, 2/3rd, cymbium 2/4 unmodified and 1/3 clavate. Tibia cylindrical, slightly outwards in the middle ventral, with one lyriform organ on ventro-prolateral side of sub-distal part (Fig.
The male of new species morphologically resembles those of geographically close L. yaoi sp. nov. on the general morphology of palpal bulb and the pattern of spines on the palpal tibia, but it can be distinguished from L. yaoi by the relatively low keel of embolus and the reduction of number of spines on male palpal tibia (Fig.
The specific epithet is derived from the type locality; noun in apposition.
Known only from the type locality of Sichuan, China (Fig.
AAAGATATTGGAACTTTATATATGATTTTTGGTGTATGATCGGCTATGCTAGGGACTGCTATAAGAGTAATTATTCGAGTTGAGCTTGGTCAGGTTGGTAGATTGTTTGGGGATGATCATTTGTATAATGTTATTGTTACTGCTCATGCTTTAGTTATGATTTTTTTTATAGTTATGCCTATTATAATTGGTGGTTTTGGGAATTGATTGCTTCCATTAATGATTGGTTCACCAGATATGGCTTTTCCTCGTATAAATAATTTAAGATTTTGATTGCTTTTCCCTTCTTTATTTTTATTGTTGTTATCTTCTATAACGGATATTGGGGTGGGTGCTGGATGGACTATTTATCCTCCATTATCTTCTGATTTAGGACATAGAGGAGGAGGGGTAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGGGTCTTCAGTAATAGGTTCTATTAATTTTATTTCTACTATTTTTAATATACGTCCTTTTGGGATAACAATAGAACGAGTTCCTTTATTTGTGTGATCTGTGTTAATTACAACTATTTTGCTTTTATTGTCTTTGCCAGTTTTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCTGGTGGTGGGGATCCGGTATTATTTCAGCATTTGTTTTGATTTTTTGGTCAC (GenBank accession number: PQ585637).
Male (Holotype, MHBU-ARA-10000056). Colouration in ethanol (Fig.
Total length 10.07. Carapace 5.21 long, 4.60 wide; opisthosoma 4.84 long, 3.59 wide. Eye group 0.47 long, 0.53 wide anteriorly, 0.65 wide posteriorly; MOA 0.35 long, front width 0.23, back width 0.45. Eye diameters and interdistance: AME 0.14, ALE 0.16, PME 0.12, PLE 0.17, AME–AME 0.12, AME–ALE 0.11, ALE–PLE 0.15, PME– PME 0.35, PME–PLE 0.03. Palpal coxa 1.78 long, 1.01 wide, bearing 11/14 spinules on prolateral-proximal corner. Sternum 3.04 long, 2.63 wide. Labium 0.43 long, 0.84 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and five stout spines, respectively; chelicerae groove with 5/5 and 3/3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: Ⅰ 13.59 (3.35, 1.49, 3.68, 3.12, 1.95), II 12.78 (3.40, 1.24, 3.33, 3.10, 1.71), III 11.80 (2.81, 1.06, 2.48, 3.13, 2.32), IV 17.96 (5.47, 2.26, 4.30, 3.91, 2.02). Spines on femora to metatarsi of legs I–II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, ventrally strong on leg I (especially distally), tip hooked, but absent on leg II; spines on prolateral tibiae of legs I few, absent on leg III, except apically, ventrally more elongate and expansive on both legs, two especially elongate adjacent spines proximally on leg II (Fig.
Palp 6.35 long (2.57, 1.08, 2.11, 0.59). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 4/4pd, 4/2rd cymbium, 4/3 unmodified and 5/5 clavate. Tibia cylindrical, transitioning to slightly narrow from proximal to distal, the distal end is half the thickness of the proximal end, with one lyriform organ on ventro-prolateral side of sub-distal part. Short strong spines of palp tibia, Mp (1-2-1-2-2-1-1)/(1-2-1-1-2-1), Mr (2-3-2-1-1)/(1-1-3-2-2-1), Drv (2)/(2). Palpal organ: tegulum oval (Fig.
Female (Paratype, MHBU-ARA-10000057). Colouration in ethanol (Fig.
Total length 14.17. Carapace 5.99 long, 4.65 wide; opisthosoma 8.17 long, 5.46 wide. Eye group 0.62 long, 0.46 wide anteriorly, 0.78 wide posteriorly; MOA 0.46 long, front width 0.27, back width 0.47. Eye diameters and interdistance: AME 0.13, ALE 0.29, PME 0.18, PLE 0.28, AME–AME 0.18, AME–ALE 0.17, ALE–PLE 0.16, PME–PME 0.32, PME–PLE 0.10. Palpal coxa 2.05 long, 1.23 wide, bearing 15/18 cuspules on prolateral-proximal corner. Sternum 3.62 long, 3.31 wide. Labium 0.97 long, 1.27 wide, without spinules or cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and seven stout spines, respectively; chelicerae groove with 5/5 and 3/3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: Ⅰ 11.27 (3.92, 2.10, 2.61, 1.50, 1.14), II 9.53 (3.38, 1.73, 1.65, 1.58, 1.19), III 7.93 (2.64, 1.48, 1.17, 1.41, 1.23), IV 13.24 (4.25, 1.94, 2.61, 2.65, 1.79). Spines of legs I–II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; the tip of most spines weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III strong; groups of short strong spines on apical and prodorsal sides of patella; tibia III shortened, without demi-saddle shape; metatarsus with numerous short, strong spines closely grouped in dorsal area, slender spines on ventro-distal. Groups of short strong spines on prolateral patella and slender spines on ventral metatarsus of Leg IV. Tarsus III–IV with ventro-distal group of stiff bristles and few slender spines. Trichobothria of legs present on proximal one-third part of tibiae I–III, proximal half part of tibia IV, distal half of metatarsi I–IV and proximal two-thirds of all tarsi; trichobothria on tibiae I–IV and metatarsi I–IV unmodified; trichobothria on tarsi I–III divided into unmodified and clavate forms, with latter only present in proximal half of tarsus, trichobothria on tarsi IV without clavate forms. Count of trichobothria on legs: I, tibia 4/4pd and 5/3rd, metatarsus 8/6, tarsus 13/11 unmodified and 5/4 clavate; II, tibia 4/5pd and 4/4rd, metatarsus 9/7, tarsus 8/7 unmodified and 4/4 clavate; III, tibia 4/4pd and 5/4rd, metatarsus 5/5, tarsus 12/9 unmodified and 3/3 clavate; IV, tibia 7/6pd and 6/6d, metatarsus 7/6, tarsus 12/14 unmodified. Tarsal claws: all paired claws with two teeth (Fig.
Vulva (Fig.
The male similar to Latouchia wenchuan sp. nov. For the differences, see Latouchia wenchuan sp. nov.. The male can be easily distinguished from the geographically close L. jinyun sp. nov. by whether spines are present on the palpal tibia.
The specific epithet is in honour to Mr. Yao Yang, a good friend of the second author who, together with the second author, collected the first specimen of this new species.
Known only from the type locality of Shaanxi, China (Fig.
The burrows of this species were found on slopes along roadsides or small riverbanks (Fig.
AAAGATATTGGAACTTTGTATATAATTTTTGGGGTGTGGTCGGCTATGGTAGGGACTGCAATAAGAGTAATCATTCGAATTGAGCTTGGACAAGTTGGAAGATTATTTGGTGATGATCATTTATATAATGTTGTTGTTACTGCTCATGCTTTAGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGCTTTGGAAATTGACTGCTTCCAATAATAATTGGTTGTCCAGATATAGCTTTTCCACGAATGAATAATTTAAGATTTTGATTGCTTCCTCCTTCTCTGTTTTTGCTTTTGTTGTCTTCTATAACAGATGTCGGAGTGGGTGCCGGTTGAACTATTTATCCTCCTTTGTCTTCTGAACTTGGCCATAGAGGTGGAGGGATAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGTGGGTCTTCGGTGATGGGTTCTATTAATTTTATTTCTACAATTTTAAATATGCGTCCTTTTGGAATGATAATGGAGCGAGTTCCTTTATTCGTGTGATCTGTATTAATTACTACTATTTTATTGTTATTATCTTTACCTGTATTGGCTGGGGCTATTACCATATTATTAACTGATCGAAATTTTAATACTTCGTTTTTTGATCCTGCTGGTGGGGGGGATCCTGTGTTGTTTCAGCATTTGTTTTGATTTTTTGGTCA (GenBank accession number: PQ585636).
Thanks to the subject editor Dr. Jeremy Miller and the two reviewers (Dr. Stuart J. Longhorn and Dr. Arthur E. Decae) for their valuable suggestions. Thanks to Jiwei Lin (林继伟), Run Wen(文润), Yao Yang (杨垚) and Shanmi Zheng (郑杉米) for providing specimens. We would like to thank Quang Duy Hoang (Tay Nguyen University) for his assistance with tracking place names in Vietnam. This study complies with local laws and has obtained the necessary permits. This study was supported by the National Natural Science Foundation of China (No. 32170468).