Biodiversity Data Journal :
Taxonomic Paper
|
Corresponding author: Tadashi Ishikawa (chuishikawa@gmail.com)
Academic editor: Jenő Kontschán
Received: 05 Jul 2017 | Accepted: 17 Aug 2017 | Published: 22 Aug 2017
© 2017 Ok-Kyung Kim, Tadashi Ishikawa, Yoshihiro Yamada, Takuma Sato, Hirosuke Shinohara, Ken Takahata
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Kim O, Ishikawa T, Yamada Y, Sato T, Shinohara H, Takahata K (2017) Incidence of pests and viral disease on pepino (Solanum muricatum Ait.) in Kanagawa Prefecture, Japan. Biodiversity Data Journal 5: e14879. https://doi.org/10.3897/BDJ.5.e14879
|
|
The solanaceous fruit crop pepino (Solanum muricatum Ait.), originating in the Andes, is grown commercially in South American countries and New Zealand. In these areas, pests and diseases of pepino have been identified well; however, to date, these have seldom been investigated in detail in Japan. Herein, we attempt to reconstruct an agricultural production system for commercial pepino crops in Japan, and evaluate the incidence of pests and viral diseases on pepino. The findings of this study will facilitate in developing a better crop system for the commercial cultivation of healthy pepino fruits.
A total of 11 species, comprising nine insects and two mites, were recognized as pests of pepino plants in our experimental fields in Kanagawa Prefecture, central Honshu, Japan. Of these pest species, the two-spotted spider mite Tetranychus urticae Koch, 1836 and the cotton aphid Aphis gossypii Glover, 1877, were remarkably abundant than the other pest species. Eventually, 13 species, including two previously recorded, are currently recognized as the pests of pepino in Japan. With regard to viruses, we tested two species Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV), as well as three genera Carlavirus, Potexvirus, and Potyvirus. No virus was detected in symptomatic pepino leaves collected in our experimental fields. This is a first report on the identification of pests on pepino plants in Kanagawa Prefecture, Japan and elucidates the relationship between currently occurring pests of pepino plants and potential viral pathogens that they can transmit.
insects, mites, virus vector, virus, sweet cucumber
Pepino, the Spanish name for sweet cucumber, (Solanum muricatum Ait.), is a solanaceous plant cultivated as a fruit crop. It originated in the Andes, became popular in several countries and regions of South America (
In 2016, our research team began a project for regional development “Launching of Nodai-branded Pepino Crop” conducted by Faculty of Agriculture, Tokyo University of Agriculture (TUA; Nodai is a Japanese abbreviated name of the university). The main purpose of this project was to produce high quality and flavorsome pepino fruits with sufficient soluble solids content. As a recent achievement of this project,
To date, at least 24 species of insect and mite pests on pepino (
It is important to establish solid pest control in its commercial cultivation to produce high quality and stable pepinos. Unfortunately, however, no pesticides applicable to pepino plants have been registered in Japan; this could be attributed to the few detailed studies on pests and diseases of pepino. Therefore, our research team has tried to comprehensively elucidate the pests and viral diseases of pepino in this project in order to contribute to the accumulation of basic knowledge toward the establishment of its pest control. This paper documents the results of our field survey on pests and diseases of pepino in Kanagawa Prefecture, central Japan.
This study was conducted at the Atsugi Campus (
All specimens were collected by beating the leaves and branches of pepino plants after observation in field. A total of 34 collections were performed in the three plots from August 30, 2016 to January 21, 2017, for a maximum of 3 h/day in the daytime. The collected insects were killed immediately after capture, using ethyl acetate; aphids, lepidopteran larvae, and mites were fixed in plastic bottles filled with 70–80% ethanol. All specimens were prepared as dry mounted, slide mounded, or ethanol preserved for morphological examination.
Identification of insect and mite specimens was performed using stereoscopic microscopes (Olympus SZ60 and Olympus SZX16, Tokyo, Japan) and optical microscopes (Olympus BH-2 and Olympus BX41, Tokyo, Japan) by TI and YY according to the following literature:
We surveyed whether pepino plants showed symptoms of virus infection such as mosaic, mottle, necrosis, or chlorosis. The symptomatic leaves were collected and used for virus detection as follows: Total RNA was extracted from the samples using Trizol reagent (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s instructions. Total RNA was used as a template for first-strand cDNA synthesis by ReverTra Ace -α-® kit (TOYOBO Co., Ltd., Osaka, Japan) followed by DNA amplification using TaKaRa Ex TaqTM PCR buffer (Takara Bio Inc., Otsu, Japan) with genus-specific or species-specific primers (Table
Target virus | Primer | Strand | Sequence (5' to 3') | Expected amplicon size (bp) | Reference |
Alfalfa mosaic virus (AMV) | AMV-F2 | + | ATCATGAGTTCTTCACAAAAGAA | 670 |
|
AMV-R2 | - | TCAATGACGATCAAGATCGTC | |||
Cucumber mosaic virus (CMV) | CPTALL-5 | + | YASYTTTDRGGTTCAATTCC | 950 |
|
CPTALL-3 | - | GACTGACCATTTTAGCCG | |||
Genus Carlavirus | Carla-uni | + | GGAGTAACCGAGGTGATACC | 120 | |
oligo dT | - | T18 | |||
Genus Potexvirus | Potex 5 | + | CAYCARCARGCMAARGAYGA | 600 |
|
Potex 2RC | - | AGCATRGCNSCRTCYTG | |||
Genus Potyvirus | CIFor | + | GGIVVIGTIGGIWSIGGIAARTCIAC | 700 |
|
CIRev | - | ACICCRTTYTCDATDATRTTIGTIGC |
In this study, a total of 498 specimens of insects and mites were collected from pepino plants on the three studied plots. Of these specimens, 459 individuals belonging to 11 species were recognized as pests of pepino. They consisted of nine insect species belonging to eight families of five orders and two mite species in two families of one order (Table
List of insect and mite pests found on pepino plants in the Atsugi Campus of Tokyo University of Agriculture (TUA), Kanagawa, Japan.
Class | Order | Family | Species | Suvery plots |
Insecta | Thysanoptera | Thripidae | Frankliniella intonsa (Trybom, 1895) | A C |
Insecta | Hemiptera | Aleyrodidae | Bemisia tabaci (Gennadius, 1889) | B C |
Insecta | Hemiptera | Aphididae | Aphis gossypii Glover, 1877 | A C |
Insecta | Hemiptera | Pseudococcidae | Phenacoccus solani Ferris, 1918 | C |
Insecta | Hemiptera | Miridae | Campylomma livida Reuter, 1885 | A |
Insecta | Coleoptera | Chrysomelidae | Epitrix hirtipennis (Melsheimer, 1847) | A C |
Insecta | Diptera | Agromyzidae | Liriomyza sativae Blanchard, 1938 | C |
Insecta | Lepidoptera | Noctuidae | Spodoptera litura (Fabricius, 1775) | A B |
Insecta | Lepidoptera | Noctuidae | Trichoplusia ni (Hübner, 1803) | B |
Arachnida | Acari | Tarsonemidae | Polyphagotarsonemus latus (Banks, 1904) | C |
Arachnida | Acari | Tetranychidae | Tetranychus urticae Koch, 1836 | A C |
Of these 11 pest species, six were detected from Plot A, three from Plot B, and eight from Plot C (Table
Regarding virus-like diseases in our research fields, pepino leaves showing necrosis were rarely found in the greenhouse (Fig.
Known as a recent alien species to Japan (
Prior to the present study, nine groups of insects and mites have been known as pests of pepino plants in Japan (Table
Class | Order | Family | Group (of species and its allies) | Species | References |
Insecta | Hemiptera | Aleyrodidae | - | Trialeurodes vaporariorum (Westwood, 1856) | |
Insecta | Hemiptera | Apididae | aphids | - | |
Insecta | Lepidoptera | Noctuidae | Helicoverpa spp. | - |
|
Insecta | Lepidoptera | Noctuidae | Spodoptera spp. | - |
|
Insecta | Lepidoptera | Gelechiidae | - | Phthorimaea operculella (Zeller, 1873) |
|
Insecta | Lepidoptera | unspecified | green caterpillars | - |
|
Arachnida | Acari | unspecified | mites | - | |
Arachnida | Acari | Tetranychidae | spider mites | - | |
Arachnida | Acari | Tetranychidae | - | Tetranychus urticae Koch, 1836 |
|
Currently, 25 species of insects and mites have been reported as pests of pepino plants worldwide (Table
Insect and mite pests of pepino plants previously recorded worldwide (excluding Japan).
Class | Order | Family | Species | Country recorded as a pest | References | Notes |
Insecta | Orthoptera | Acrididae | Schistocerca cancellata (Serville, 1838) | Chili |
|
|
Insecta | Thysanoptera | Thripidae | Frankliniella occidentalis (Pergande, 1895) | Chili |
|
Distributed in Japan |
Insecta | Thysanoptera | Thripidae | Thrips tabaci Lindeman, 1889 | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Aphididae | Aulacorthum solani (Kaltenbach, 1843) | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Aphididae | Macrosiphum euphorbiae (Thomas, 1878) | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Aphididae | Myzus persicae (Sulzer, 1776) | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Pseudococcidae | Phenacoccus solenopsis Tinsley, 1898 | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Pseudococcidae | Pseudococcus viburni (Signoret, 1875) | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Psyllidae | Russelliana solanicola Tuthill, 1959 | Chili |
|
|
Insecta | Hemiptera | Triozidae | Trioza chenopodii Reuter, 1876 | Chili |
|
Distributed in Japan |
Insecta | Hemiptera | Cicadellidae | Xerophloea viridis (Fabricius, 1794) | Chili |
|
|
Insecta | Hemiptera | Cicadellidae | Paratanus exitiosus (Beamer, 1943) | Chili |
|
|
Insecta | Diptera | Agromyzidae | Liriomyza huidobrensis (Blanchard, 1926) | Chili |
|
Distributed in Japan |
Insecta | Diptera | Tephritidae | Rhagoletis nova (Schiner, 1868) | Chili |
|
|
Insecta | Lepidoptera | Noctuidae | Agrotis bilitura Guenée, 1852 | Chili |
|
|
Insecta | Lepidoptera | Noctuidae | Copitarsia turbata (Herrich-Schaeffer, 1855) | Chili |
|
|
Insecta | Lepidoptera | Noctuidae | Trichoplusia ni (Hübner, [1803]) | Chili |
|
Recognized as a pest in Japan by this study |
Insecta | Lepidoptera | Sphingidae | Manduca sexta (Linnaeus, 1763) | Chili |
|
Distributed in Japan |
Insecta | Lepidoptera | Gelechiidae | Phthorimaea operculella (Zeller, 1873) | Chili |
|
Distributed in Japan |
Insecta | Lepidoptera | Gelechiidae | Symmetrischema tangolias (Gyen, 1913) | Chili |
|
|
Insecta | Lepidoptera | Gelechiidae | Tuta absoluta (Meyrick, 1917) | Chili |
|
Distributed in Japan |
Insecta | Lepidoptera | Crambidae | Sceliodes cordalis (Doubleday, 1843) | New Zealand |
|
|
Arachnida | Acari | Eriophyidae | Aculops lycopersici (Tryon, 1917) | Chili, Turkey | Distributed in Japan | |
Arachnida | Acari | Tarsonemidae | Polyphagotarsonemus latus (Banks, 1904) | Chili |
|
Recognized as a pest in Japan by this study |
Arachnida | Acari | Tetranychidae | Tetranychus urticae Koch, 1836 | Chili |
|
Recognized as a pest in Japan by this study |
The presence of pests can directly affect agricultural production and it may contribute to the transmission of plant viruses followed by economic losses. Bemisia tabaci, well-known as one of the most important whiteflies in terms of virus transmission, is widely distributed in the world, and is a vector of viruses of the genera Begomovirus, Carlavirus, Crinivirus, Ipomovirus, and Torradovirus (
Insect vector | Transmissible genus or species of virus | Reference |
Frankliniella intonsa | Groundnut ringspot virus |
|
Impatiens necrotic spot virus | ||
Tomato chlorotic spot virus | ||
Tomato spotted wilt virus | ||
Bemisia tabaci | Genus Begomovirus |
|
Genus Carlavirus | ||
Genus Crinivirus | ||
Genus Ipomovirus | ||
Genus Torradovirus | ||
Aphis gossypii | Cucumber mosaic virus (CMV) |
|
Papaya ringspot virus (PRSV) | ||
Tobacco ringspot virus (TRSV) |
|
|
Zucchini yellow mosaic virus (ZYMV) |
|
|
Epitrix hirtipennis | Tobacco ringspot virus (TRSV) |
|
Liriomyza sativae | Celery mosaic virus (CeMV) |
|
Watermelon mosaic virus strain 1* |
||
Watermelon mosaic virus strain 2 | ||
Tetranychus urticae | Tobacco mosaic virus (TMV)* |
|
Potato virus X (PVX)* |
We found virus-like symptoms, showing mottle and deformation on pepino leaves. However, none of the tested viruses were detected in any plant. Our internet-based image searching results showed that the symptoms were similar to those on pepper or chili plants by Polyphagotarsonemus latus.
No related virus was detected in the present study, whereas two virus species had been detected from pepino plants in Japan: Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV) inducing chlorotic ring spots and mosaic symptoms on pepino plants, respectively (
Family | Genus | Species | Acronym | Symptoms on pepino | First reported country | Reference |
Alphaflexiviridae | Potexvirus | Pepino mosaic virus | PepMV | yellow mosaic in young leaves | Peru |
|
Betaflexiviridae | Carlavirus | Potato virus H | PVH | symptomless | China |
|
Pepino latent virus* |
PepLV | symptomless | New Zealand |
|
||
Bromoviridae | Alfamovirus | Alfalfa mosaic virus | AMV | chlorotic ring spot | Japan |
|
Cucumovirus | Cucumber mosaic virus | CMV | mosaic | Japan |
|
We are highly grateful to all the members of our project for kindly offering materials, supporting our field investigations and/or providing valuable comments on the manuscript. We also thank the members of the Laboratory of Vegetables and the Laboratory of Plant Pathology for their committed cultivation and management of pepino plants in our experimental fields. We are also indebted to Jenő Kontschán (Hungarian Academy of Sciences, Hungary) and Alina Avanesyan (Grand View University, USA) for their critical reading of the manuscript and for giving valuable comments. This study was financially supported by the Strategic Research Project from Tokyo University of Agriculture, Tokyo, Japan. We would like to thank Editage (www.editage.jp) for English language editing.
Reclassified as PRSV (
Experimentally transmissible
Reclassified as an isolate of Potato virus S (PVS) based on biological and serological characteristics (