Biodiversity Data Journal :
Single Taxon Treatment
|
Corresponding author: Hao Yu (insect1986@126.com), Yang Zhong (hubeispider@aliyun.com)
Academic editor: Yanfeng Tong
Received: 22 Mar 2021 | Accepted: 22 Apr 2021 | Published: 29 Apr 2021
© 2021 Zuxian Zeng, Da Wang, Wanjuan Song, Hao Yu, Yang Zhong
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zeng Z, Wang D, Song W, Yu H, Zhong Y (2021) Clubiona jiugong sp. nov., the fifth species of C. zilla-group from China (Araneae: Clubionidae). Biodiversity Data Journal 9: e66260. https://doi.org/10.3897/BDJ.9.e66260
|
|
The Clubiona zilla-group is a relatively small species group, distributed exclusively in East Asia, with only three species clearly documented so far.
Clubiona hooda Dong & Zhang, 2016, which was previously placed in the C. trivialis-group, is assigned to the C. zilla-group in the present paper. A new spider of the C. zilla-group from Jiugong Mountain in China is described under the name of C. jiugong sp. nov. Detailed descriptions and photographs of the new species are provided.
new species, morphology, diagnosis, DNA barcode, taxonomy
The female of Clubiona zilla Dönitz & Strand, 1906 was reported by
According to
While examining spiders collected from Jiugong Mountain, Hubei Province, China (Fig.
Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong).
Male left palp of the holotype of Clubiona jiugong sp. nov. A. Prolateral view; B. Rretrolateral view; C. Bulb, prolateral view; D. Bulb, ventral view; E. Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bars: 0.1 mm (equal for A and B, equal for C–E).
Specimens in this study were collected by hand collecting from leaf-litter in Mt. Jiugong, Hubei. Spiders were fixed and preserved in 95% ethanol. Specimens were examined with an Olympus SZX7 stereomicroscope, details being studied with an Olympus CX41 compound microscope. Female epigynes and male palps were examined and illustrated after being dissected. Epigynes were removed and cleared in warm lactic acid before illustration. The vulva was also imaged after being embedded in Arabic gum. Photos were made with a Cannon EOS70D digital camera mounted on an Olympus CX41 compound microscope. The digital images were taken and assembled using Helifocus 3.10.3 software package (
A DNA barcode was also obtained for the species matching. A partial fragment of the mitochondrial cytochrome oxidase subunit I (CO1) gene was amplified and sequenced for two specimens, using the primers LCOI1490 (5’-GGTCAACAAATCATAAAGATATTG-3’) and HCOI2198 (5’-TAAACTTCAGGGTGACCAAAAAAT-3’). For additional information on extraction, amplification and sequencing procedures, see
All measurements were obtained using an Olympus SZX7 stereomicroscope and given in millimetres. Eye diameters are taken at the widest point. The total body length does not include chelicerae or spinnerets length. Leg lengths are given as total length (femur, patella, tibia + metatarsus, tarsus). Most of the terminologies used in text and figure legends follow
All specimens are deposited Museum of Guizhou Education University, Guiyang, Guizhou, China (MGEU, curator Hao Yu).
Male (Fig.
Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A–D); 1 mm (equal for E and F, equal for G and H).
Colour of the living holotype male was dark brown with red brown abdomen (Fig.
Abdomen red in ethanol (Fig.
Legs uniformly yellowish-brown in ethanol (Fig.
Palp (Fig.
Female (Fig.
Epigyne (Fig.
DNA barcode
5'CTTGATCTGCTATAGCAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTAGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTGTTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGATCCAGCTGGAGGGGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (holotype, YHCLU0274; GenBank: MZ020606)
DNA barcode
5'TTTGATCTGCTATAGTAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTGGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCCCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTATTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (paratype, YHCLU0275; GenBank: MZ020605)
Clubiona jiugong sp. nov. resembles the other zilla-group species by the similar habitus (tiny body with length not exceeding 4 mm), but is consistently separable by its genitalia. Male of the new species resembles that of C. hooda (
The species name is derived from the name of the type locality; noun in apposition.
Known from the Mt. Jiugong, Hubei Province, China (Fig.
The holotype of C. jiugong sp. nov. was obtained from foliage in a bush close to a mountain road in the core zone of Jiugong mountain range.
The zilla-group morphologically is very similar to the trivialis-group. According to previous publications (
The zilla-group presents a distinct set of characters, is one of the most distinct groups of the genus Clubiona sensu lato and has been considered as putatively monophyletic (
The genus Clubiona is very diverse and, so far, more than 500 valid species have been described. Before splitting such a genus, all current species should be considered, which certainly requires a large-scale study (i.e. a worldwide phylogenetic revision). The present study follows
The manuscript benefited greatly from comments by Drs. Zhiyuan Yao (Shenyang, China) and a anonymous reviewer. We are especially grateful to Yanfeng Tong (Shenyang, China), the subject editor of this manuscript. This work was supported by the Natural Science Foundation of Guizhou Province (J [2020] 1Y081) and the National Natural Sciences Foundation of China (NSFC-32060113/31702006) to Hao Yu, the National Natural Sciences Foundation of China (NSFC-32000303), the PhD grant from Hubei University Science and Technology (BK201811) and the Natural Sciences Foundation of Hubei Province (2019CFB248) to Yang Zhong, the Research of Species Diversity of Jiugongshan National Nature Reserve (2021HX003), the Guizhou Education University Academic Discipline Project (2019YLPYXKB01) and the Guizhou provincial first-class major (biological science) project (Education Department of Guizhou Province [2019] 46).