Biodiversity Data Journal :
Single Taxon Treatment
|
Corresponding author: Hao Yu (insect1986@126.com)
Academic editor: Yanfeng Tong
Received: 08 Apr 2022 | Accepted: 05 May 2022 | Published: 12 May 2022
© 2022 Jianshuang Zhang, Wanling Zhang, Langju Deng, Qianle Lu, Hao Yu
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhang J, Zhang W, Deng L, Lu Q, Yu H (2022) Synema guiyang sp. nov., the fourth endemic species of Synema Simon, 1864 (Araneae, Thomisidae) from China. Biodiversity Data Journal 10: e85072. https://doi.org/10.3897/BDJ.10.e85072
|
|
Synema Simon, 1864 is a relatively large genus of family Thomisidae Sundevall, 1833 and currently includes 124 species distributed worldwide, except for the Polar Regions. However, Synema can be regarded as being poorly represented in China, with only seven species, three of which are endemic.
A new spider species of the genus Synema from Guiyang City in China, is described under the name of S. guiyang J. Zhang, Q. Lu & H. Yu, sp. nov. Detailed descriptions and photographs of the new species are provided. DNA barcodes (a partial fragment of the mitochondrial cytochrome oxidase subunit I gene, COI) of the species were obtained to confirm matching of the sexes and for future use in molecular studies.
crab spiders, morphology, DNA barcoding, diagnosis, taxonomy
The Thomisidae is one of the largest spider families, with 171 genera and 2159 valid species distributed worldwide, 51 genera and 306 species of which are recorded from China (
Synema is the fourth most speciose genus of Thomisidae and includes 124 species so far, after Xysticus C. L. Koch, 1835 (293 species), Tmarus Simon, 1875 (226 species) and Thomisus Walckenaer, 1805 (143 species) (
While examining spiders collected from Guiyang City, Guizhou Province, south-western China (Fig.
Male left palp of the holotype of Synema guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: E = embolus; EB = embolar base; ET = embolar tip; ITA = intermediate tibial apophysis; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum; VTA = ventral tibial apophysis. Scale bar: 0.2 mm (equal for A–D).
Synema guiyang sp. nov., female paratype and male holotype, epigyne (A–D), frontal views of prosoma (E–F). A–B Macerated epigyne, ventral and dorsal; C–D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal; E Male; F Female. Abbreviations: A = atrium; AM = atrial membrane; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; H = hood; SP = spermatheca. Scale bars: 0.2 mm (equal for A–D); 1 mm (E, F).
Specimens in this study were collected by hand collecting from leaf-litter in Guiyang Forest Park, Guiyang, Guizhou. Spiders were fixed and preserved in 95% ethanol. Specimens were examined with an Olympus SZX7 stereomicroscope; details were studied with an Olympus CX41 compound microscope. Female epigynes and male palps were examined and illustrated after being dissected. Epigynes were removed and cleared in warm lactic acid before illustration. The vulva was also imaged after being embedded in Arabic gum. Photos were made with a Cannon EOS70D digital camera, mounted on an Olympus CX41 compound microscope. The digital images were taken and assembled using the Helifocus 6.80 software package. The distribution map was generated with Google Earth Pro 7.3.2 (Google Limited Liability Company).
A DNA barcode was also obtained for the species matching. A partial fragment of the mitochondrial cytochrome oxidase subunit I (CO1) gene was amplified and sequenced for 21 specimens, using the primers LCOI1490 (5’-GGTCAACAAATCATAAAGATATTG-3’) and HCOI2198 (5’-TAAACTTCAGGGTGACCAAAAAAT-3’). For additional information on extraction, amplification and sequencing procedures, see
All measurements were obtained using an Olympus SZX7 stereomicroscope and given in millimetres. Eye diameters were taken at the widest point. The total body length does not include the length of the chelicerae or spinnerets. Leg lengths are given as total length (femur, patella, tibia + metatarsus, tarsus). Most of the terminologies used in text and figure legends follow
All specimens are deposited at the Museum of Guizhou Education University, Guiyang, Guizhou, China (MGEU, curator Hao Yu).
Male (holotype) (Fig.
Carapace (Fig.
Abdomen (Fig.
Legs basically yellowish-brown (Fig.
Palp (Fig.
Female (Fig.
Epigyne (Fig.
DNAbarcode: 5'TATTTGGAGCTTGATCTGCTATAGTAGGGACAGCTATAAGAGTGTTAATTCGTATGGAATTAGGA AGATCTGGAAGATTATTAGGAAATGATCATCTTTATAATGTAATTGTTACCGCTCATGCTTTTGTTATGATTTTTTTTATA GTAATACCTATTTTAATTGGGGGTTTTGGAAATTGATTAGTACCTTTAATGTTAGGGGCTCCTGATATATCTTTCCCTCG GATGAATAATTTATCTTTTTGATTATTACCCCCTTCATTATTTTTATTATTTATATCTTCTATAGTAGAGGTAGGTGTAGGG GCAGGATGAACTGTTTATCCTCCTTTAGCTTCTAGAGTTGGGCATATAGGAGGATCTATAGATTTTGCTATTTTTTCTTT ACATTTAGCTGGAGCTTCTTCTATTATAGGAGCGGTTAATTTTATTTCTACTATTATTAATATACGAACTAGAGGTATAAG AATAGAAAAGGTTCCTTTGTTTGTATGATCTGTATTAATTACAGCTATTTTACTTCTTTTGTCTTTACCTGTATTAGCAGG TGCTATTACTATATTATTAACTGATCGTAATTTTAACACTTCTTTTTTTGATCCTGCAGGGGGAGGGGATCCAATTTTATT TCAACATTTGTTTTGATTTTT3' (holotype, YHTHO002; GenBank: ON435709).
DNAbarcode: 5'TATTTGGAGCTTGATCTGCTATAGTAGGGACGGCTATAAGAGTGTTAATTCGTATGGAATTAGGA AGATCTGGAAGATTATTAGGAAATGATCATCTTTATAATGTAATTGTTACCGCTCATGCTTTTGTCATGATTTTTTTTATA GTAATACCTATTTTAATTGGGGGTTTTGGAAATTGATTAGTACCTTTAATGTTAGGGGCTCCTGATATATCTTTCCCTCG GATAAATAATTTATCTTTTTGATTATTACCCCCTTCATTATTTTTACTATTTATATCTTCTATAGTAGAGGTAGGTGTGGGG GCAGGATGAACTGTTTATCCTCCTCTAGCTTCTAGAGTTGGGCATATAGGAGGATCTATAGATTTTGCTATTTTTTCTTT ACATTTAGCTGGGGCTTCTTCTATTATAGGGGCGGTTAATTTTATTTCTACTATTATTAATATACGAACTAGAGGTATAAG AATAGAAAAGGTTCCTTTGTTTGTATGATCTGTATTAATTACAGCTATTTTACTTCTTTTGTCTTTACCTGTATTAGCAGG TGCTATTACTATATTATTAACTGATCGTAATTTTAACACTTCTTTTTTTGATCCTGCAGGGGGAGGGGATCCAATTTTATT TCAACATTTGTTTTGATTTTT3' (paratype, YHTHO003; GenBank: ON435708).
The new species resembles S. albomaculatum and S. chikunii in having the similar habitus (abdomen dorsally with characteristic spots) (cf. Fig.
The species name is derived from the name of the type locality; noun in apposition.
Known from the Guiyang City, Guizhou Province, China (Fig.
Synema guiyang sp. nov. is a typical leaf-dwelling spider. The types were obtained from foliage in woods in the core zone of Guiyang Forest Park.
As two members of Talaini, the genus Synema is easily confused with siblings Spilosynema in general appearance. According to the diagnosis provided by
However, some genitalic characteristics are not mentioned in the diagnosis of
The manuscript benefited greatly from comments by Dr. Zhiyuan Yao (Shenyang, China), Dr. Keke Liu (Jian, China) and a anonymous reviewer. We are especially grateful to Yanfeng Tong (Shenyang, China), the subject editor of this manuscript. This work was supported by the Project of Biodiversity Survey and Assessment in Guiyang (GZZC-2021-018), the Natural Science Foundation of Guizhou Province (J [2020] 1Y081), the National Natural Sciences Foundation of China (NSFC-32060113/31702006), Guizhou Education University Academic Discipline Project (2019YLPYXKB01) and Guizhou provincial first-class major (biological science) project (Education Department of Guizhou Province [2019] 46).