Biodiversity Data Journal :
Taxonomy & Inventories
|
Corresponding author: Xusheng Gong (gxs5339@stu.hubu.edu.cn), Hao Yu (insect1986@126.com)
Academic editor: Emma McCarroll Shaw
Received: 11 Sep 2022 | Accepted: 18 Oct 2022 | Published: 24 Oct 2022
© 2022 Yang Zhong, Xusheng Gong, Hao Yu
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhong Y, Gong X, Yu H (2022) A new species of the Clubiona corticalis-group (Araneae, Clubionidae) from Jiugong Mountains, Hubei Province, central China. Biodiversity Data Journal 10: e94735. https://doi.org/10.3897/BDJ.10.e94735
|
The corticalis group is one of most diverse species-group in genus Clubiona Latreille, 1804. Currently, a total of 81 corticalis group species are known worldwide, amongst them 67 were recorded from China. However, the diversity of this group in China is still insufficiently known.
Clubiona xianning sp. nov. is described as a new species of the C. corticalis species-group collected from Hubei Province, China.
Sac spiders, morphology, DNA barcoding, diagnosis, taxonomy
Clubiona Latreille, 1804 currently contains 518 catalogued species that are found worldwide, except for the Polar Regions and South America (
While examining spiders collected from Jiugong Mountains, Hubei Province, China (Fig.
Male left palp of the holotype of Clubiona xianning sp. nov. A Prolateral view; B Rretrolateral view; C Bulb, prolateral view; D Bulb, ventral view; E Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EB = embolic base; RTA = retrolateral tibial apophysis; VTA = ventral tibial apophysis. Scale bars: 0.2 mm (equal for A and B, equal for C–E).
Specimens in this study were collected by hand collecting from leaf-litter in Mt. Jiugong, Hubei. Spiders were fixed and preserved in 95% ethanol. Specimens were examined with an Olympus SZX7 stereomicroscope; details were studied with an Olympus CX41 compound microscope. Female epigyne and male palp were examined and illustrated after being dissected. The epigyne was removed and cleared in warm lactic acid before illustration. The vulva was also imaged after being embedded in Arabic gum. Photos were made with a Cannon EOS70D digital camera mounted on an Olympus CX41 compound microscope. The digital images were taken and assembled using Helifocus 6.80 software package. The distribution map was generated with Arcgis 10.5 (Environmental Systems Research Institute, Inc.).
A DNA barcode was also obtained for species matching. A partial fragment of the mitochondrial cytochrome oxidase subunit I (CO1) gene was amplified and sequenced for two specimens, using the primers LCOI1490 (5’-GGTCAACAAATCATAAAGATATTG-3’) and HCOI2198 (5’-TAAACTTCAGGGTGACCAAAAAAT-3’) (
All measurements were obtained using an Olympus SZX7 stereomicroscope and given in millimetres. Eye diameters are taken at the widest point. The total body length does not include chelicerae or spinnerets length. Leg lengths are given as total length (femur, patella, tibia + metatarsus, tarsus). Most of the terminologies used in text and figure legends follows
All specimens are deposited Museum of Guizhou Normal University, Guiyang, Guizhou, China.
Male (Fig.
Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H).
Colour of the living holotype male was uniformly brown (Fig.
Abdomen (Fig.
Legs uniformly yellowish-white in ethanol (Fig.
Palp (Fig.
Female (Fig.
Epigyne (Fig.
5'TTCTGGTCAGCTATAGTTGGTACAGCTATAAGAGTTATAATTCGTATAGAATTAGGTCAATCTGGAGCTTTTTTAGGTGATGATCATTTGTATAATGTAGTAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGAAATTGATTAGTTCCATTAATATTAGGGGCAGGTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGACTTTTACCACCTTCATTAATATTATTAGTTATATCATCTATGGCTGAGATGGGAGTTGGGGCTGGATGAACAGTTTATCCCCCTCTTGCTTCTTTAGTAGGTCATACGGGAAGAGCAATGGATTTTGCTATTTTTTCATTACATTTAGCTGGGGCTTCTTCTATTATAGGAGCTGTTAATTTTATTACTACTATTATGAATATACGATCTTTTGGAATAATAATGGAAAAGATTTCATTATTTGTTTGGTCTGTTTTAATTACAGCTATTTTATTATTATTATCTTTGCCAGTTTTAGCCGGGGCTATTACTATATTATTAACTGATCGTAATTTTAATACGTCTTTTTTTGACCCTGCTGGGGGAGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCACCC3' (holotype, YHCLU0272; GenBank: OP675437)
5'TCTGGTCAGCTATAGTTGGTACAGCTATAAGAGTTATAATTCGTATAGAATTAGGTCAATCTGGAGCTTTTTTAGGTGATGATCATTTGTATAATGTAGTAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGAAATTGATTAGTTCCATTAATATTAGGGGCAGGTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGACTTTTACCACCTTCATTAATATTATTAGTTATATCATCTATGGCTGAGATGGGAGTTGGGGCTGGATGAACAGTTTATCCCCCTCTTGCTTCTTTAGTAGGTCATACGGGAAGAGCAATGGATTTTGCTATTTTTTCATTACATTTAGCTGGGGCTTCTTCTATTATAGGAGCTGTTAATTTTATTACTACTATTATGAATATACGATCTTTTGGAATAATAATGGAAAAGATTTCATTATTTGTTTGGTCTGTTTTAATTACAGCTATTTTATTATTATTATCTTTGCCAGTTTTAGCCGGGGCTATTACTATATTATTAACTGATCGTAATTTTAATACGTCTTTTTTTGACCCTGCTGGGGGAGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCACCC3' (paratype, YHCLU0273; GenBank: OP675436).
Male of the new species resembles that of C. caohai Zhang & Yu, 2020 (
The specific name refers to the type locality and is a noun in apposition.
Known from the Mt. Jiugong, Hubei Province, China (Fig.
We thank Jie Liu (Wuhan, China), Hirotsugu Ono (Ibaraki-ken, Japan) and a anonymous referee for providing constructive comments on an earlier version of the manuscript. We are especially grateful to Emma McCarroll Shaw (Chiang Mai, Thailand), the subject editor of this manuscript. We are also grateful to Qianle Lu (Shenzhen, China) for his kind help in collecting the specimens and for agreeing to use his picture of live specimens. This work was supported by the National Natural Sciences Foundation of China (NSFC-32060113/32000303), the Natural Science Foundation of Guizhou Province (J [2020] 1Y081), the Natural Sciences Foundation of Xianning City (2022ZRKX063), the Hubei Province Key Laboratory of Conservation Biology for Shennongjia Golden Monkey Foundation (No. SNJKL2021003) and the Special Fund Projects of Hubei Key Laboratory of Radiation Chemistry and Functional Materials (2021ZX12).