Biodiversity Data Journal :
Taxonomy & Inventories
|
Corresponding author: Ye-Jie Lin (linyejie15@gmail.com), Chunyan Xie (xcy8046@163.com)
Academic editor: Alireza Zamani
Received: 18 Oct 2022 | Accepted: 01 Nov 2022 | Published: 03 Nov 2022
© 2022 Ye-Jie Lin, Shuqiang Li, Chunyan Xie
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lin Y-J, Li S, Xie C (2022) A new species of Chilobrachys (Araneae, Theraphosidae) from Guangdong, China. Biodiversity Data Journal 10: e96467. https://doi.org/10.3897/BDJ.10.e96467
|
|
The theraphosid spider genus Chilobrachys Karsch, 1892 contains 30 species, almost entirely limited to Indochina, India, Sri Lanka and China. Six species of Chilobrachys are currently known from China: C. dominus Lin & Li, 2022 (Yunnan), C. guangxiensis (Yin & Tan, 2000) (Guangxi, Hainan), C. hubei Song & Zhao, 1988 (Hubei, Chongqing), C. jinchengi Lin & Li, 2022 (Tibet), C. liboensis Zhu & Zhang, 2008 (Guizhou, Guangxi) and C. lubricus Yu et al., 2021 (Yunnan).
A new species, Chilobrachys qishuoi Lin & Li, sp. n., is described from Guangdong, China, on the basis of both sexes. This is the easternmost Chilobrachys species known. Photos and a morphological description of the new species are provided. Type materials are deposited in the Institute of Zoology, Chinese Academy of Sciences (IZCAS) in Beijing, China.
The spider family Theraphosidae Thorell, 1869, commonly known as tarantulas, currently comprises 1041 species in 156 genera, of which Chilobrachys Karsch, 1892 contains 30 species, almost entirely limited to Indochina, India, Sri Lanka and China (
The most distinctive feature of this genus is the basal, ventrally standing knife-like strikers on the chelicerae and a single or double row of paddle hairs (lyra) overlapped by a fringe of lesser stridulating setae on the maxillae (
Here, we describe a new species: Chilobrachys qishuoi sp. n. from Qingyuan, Guangdong. It is the easternmost Chilobrachys species known.
All specimens were preserved in 75% ethanol and the type specimens of Chilobrachys qishuoi sp. n. were deposited in the Institute of Zoology, Chinese Academy of Sciences in Beijing (IZCAS). Spermathecae were cleared in trypsin enzyme solution to dissolve non-chitinous tissues. Specimens were examined using a LEICA M205C stereomicroscope. Photomicroscopy images were taken with an Olympus C7070 zoom digital camera (7.1 megapixels). Laboratory habitus photographs were taken with a Sony A7RIV digital camera equipped with a Sony FE 90 mm Goss lens. Photos were stacked with Helicon Focus (v. 7.6.1) or Zerene Stacker (v. 1.04) and processed in Adobe Photoshop CC2022.
All measurements are in millimetres and were obtained with an Olympus SZX16 stereomicroscope with a Zongyuan CCD industrial camera. Body length was measured without chelicerae. Eye sizes were measured as the maximum diameter from either the dorsal or frontal view. The largest stridulatory seta was selected as the sample. The length of the contraction area is defined as the length from the position on the stalks that is as wide as the spermathecal lobe to the neck. The length of the spermathecal lobe is defined as the length from the neck to the terminal of the spermathecal lobe. The length of stalks is defined as the length from the neck to the end of the receptacles. Leg measurements are given as follows: total length (femur, patella, tibia, metatarsus, tarsus). The terminology used in the text and figures follows
A total of 366 bases of cytochrome oxidase I were sequenced by using the following primers: ExtA (5’-GAAGTTTATATTTTAATTTTACCTGG-3’) and ExtB (5’-CCTATTGAWARAACATARTGAAAATG-3’). This PCR profile consisted of an initial denaturing step at 94°C for 2 min, 30 amplification cycles [94°C for 30 s, 50°C or optimal annealing temperature (Tm°C) for 45 s, 72°C for 45 s], followed by a final extension step at 72°C for 5 min.
Materials from the following institutions were examined or had images of type material supplied to the authors: IZCAS Institute of Zoology, Chinese Academy of Sciences; MHBU Museum of Hebei University.
Abbreviations: A apical keel; ALE anterior lateral eyes; AME anterior median eyes; BRV base to receptacle value; BSE base separation extent; CA contraction area; EO embolic opening; LBW lobe to base width; LRV lobe to receptacle value; LSE lobe separation extent; MOA median ocular area; NBW neck to base width; NLW neck to lobe width; PI prolateral inferior keel; PLE posterior lateral eyes; PLS posterior lateral spinneret; PME posterior median eyes; PMS posterior median spinneret; PS prolateral superior keel; SL spermathecal lobes; St stalks; TA tegular apophysis.
Chilobrachys dominus Lin & Li, 2022, holotype male, Ar42676, China, Ynnnan, Jinghong, IZCAS.
Chilobrachys guangxiensis (Yin & Tan, 2000), 2 males, without institution ID, China, Guangxi, Longzhou; 1 female, without institution ID, China, Hainan, Sanya, IZCAS.
Chilobrachys hubei Song & Zhao, 1988, 1 male, 1 female, without institution ID, China, Hubei, Badong (type locality), MHBU.
Chilobrachys jinchengi Lin & Li, 2022, holotype male, paratype male, Ar42677, Ar42678, respectively, China, Tibet, Medog, IZCAS.
Chilobrachys liboensis Zhu & Zhang, 2008, 1 male, without institution ID, China, Guizhou, Libo (type locality), IZCAS.
Chilobrachys lubricus Yu, Zhang, Zhang, Li & Yang, 2021, holotype male, one paratype female, without institution ID, China, Yunnan, Yuxi, MHBU.
Male (holotype, IZCAS-Ar43549) (Fig.
Tip of embolus of Chilobrachys species in China. Abbreviations: A apical keel; EO embolic opening; PI prolateral inferior keel; PS prolateral superior keel.
Colouration in alcohol: Carapace, palp and legs red brown. Chelicerae and abdomen black (Fig.
Carapace 11.27 long, 9.82 wide, with long white setae. Eye group 2.02 long, 0.91 wide. MOA 1.24 long, anterior width 0.96, posterior width 1.24 (Fig.
Chelicera 6.94 long, 4.80 high, with long white grey setae. Promargin with dense brown hairs, retromargin with one row of 11 teeth, fang furrow with 35 denticles, strikers spiniform. Fang 5.54 long (Fig.
Labium 1.68 long, 2.21 wide, with 457 cuspules, covering almost 1/3 of area of labium, terminal brown, with long bristles (Fig.
Maxilla 4.73 long, 2.18 wide, with 267 cuspules. Stridulating lyra almost two times longer than height, with two kinds of stridulating setae: one row of 10 club-shaped, straight setae and dense spiniform setae (Fig.
Sternum 5.20 long, 4.47 wide, yellow brown, covered with two kinds of hairs: black erect bristles and non-erect brown hairs, separated from labium by fan-shaped areas. Three pairs of sigilla present, anterior pair small, oval; posterior pairs larger (Fig.
Legs with dense long and white setae on patellae and tibiae, without any spines. Tarsi I–III with 2 claws, tarsus IV with 3 claws, without denticle. Leg measurements: I 43.11 (12.46 + 4.92+ 11.17 + 8.57 + 5.99), II 37.47 (10.34 + 3.47 + 9.99 + 7.74 + 5.93), III 31.93 (8.07 + 3.28 + 8.09 + 8.12 + 4.37), IV 44.09 (11.57 + 3.45 + 11.55 + 11.92 + 5.60). Leg formula: 4123. Scopula on tarsus IV cracked by a band of macrosetae, scopulae of tarsi I–III not divided.
Abdomen 12.11 long, 6.37 wide, oval, without any pattern, covered with long light brown and white setae of varying lengths. PMS 1.75 long, PLS 8.99 long.
Palp (Fig.
Female (one paratype, IZCAS-Ar43552) (Fig.
Colouration in alcohol: Same as in male (Fig.
Carapace 18.75 long, 16.54 wide, with long light brown setae. Eye group 6.41 long, 2.72 wide. MOA 2.19 long, anterior width 2.87, posterior width 4.45 (Fig.
Chelicera 10.68 long, 7.93 high, with long light brown setae. Promargin with dense brown hairs, retromargin with one row of 18 teeth, fang furrow with 94 denticles, strikers spiniform. Fang 8.68 long (Fig.
Labium 2.60 long, 2.98 wide, with 580 cuspules, others as in male (Fig.
Maxilla 8.02 long, 4.29 wide, with 580 cuspules. Stridulating lyra almost three times longer than its height, others as in male (Fig.
Sternum 8.48 long, 5.13 wide, others as in male (Fig.
Legs with long and short brown setae, others as in male. Leg measurements: I 52.92 (15.19 + 6.58+ 13.56 + 9.37 + 8.22), II 45.25 (13.09 + 5.90 + 11.21 + 8.67 + 6.38), III 40.12 (10.16 + 5.30 + 9.04 + 9.04 + 6.58), IV 51.89 (13.47 + 5.46 + 12.72 + 13.18 + 7.06). Leg formula: 1423.
Abdomen 20.36 long, 12.38 wide, covered with long light brown setae of varying lengths. PMS 2.75 long, PLS 11.87 long.
Spermathecae (Fig.
The new species is similar in habitus to C. hubei: the male with dense white setae on carapace, patellae and tibiae and the female with light brown carapace and chelicerae (Fig.
However, the male of C. qishuoi sp. n. can be distinguished from that of C. hubei by the apical keel with an angle range of 60° to 90° (Fig.
The species is named after Mr. Shuo Qi, who collected type material; noun (name) in genitive case.
The specimens were found in barren limestone rock walls with some vegetation (Fig.
CTATTATTAGATCATCTGTTGGGAAGCGTGAGCCCTTCGGAACTTTGGGAATAATTTATGCTATGGTTAGAATTGGTGGGATGGGGTTTGTTGTATGAGCTCATCATATGTTTTCTGTGGGAATAGATGTAGATACGCGGGCATATTTTACGGCAGCAACTATGGTGATTGCTGTCCCTACGGGAATTAGGGTATTTAGATGAATAGCTACGTTGTATGGATCTTACTTTAAGATGGATACCTCTTTGATATGGTGTGTTGGGTTCGTTTTTTTGTTTACTTTAGGGGGATTAACCGGGGTGGTTTTGGCTAATTCTTCTTTGGATATTATTTTGCATGATACTTATTATGTGGTTGCTCATTTTC (Ar43552, GenBank accession number OP394115).
The manuscript benefited greatly from comments by Alireza Zamani, Rick C. West and Volker von Wirth. Danni Sherwood (UK) checked the English. Shuo Qi (Guangdong, Sun Yat-Sen University), Hanming Song (Guangdong, Sun Yat-Sen University), Yongyou Zhao (Guangdong, Shimentai National Nature Reserve), Fengbin Yu (Guangxi) and Jincheng Liu (Beijing) helped with the fieldwork. This research was supported by the National Natural Science Foundation of China (NSFC-31972869).