Biodiversity Data Journal :
Research Article
|
Corresponding author: Juan Fernando Díaz-Nieto (jdiazni@eafit.edu.co)
Academic editor: Caio J. Carlos
Received: 22 Feb 2021 | Accepted: 02 May 2021 | Published: 21 May 2021
© 2021 Paulo Pulgarín-R, Martha Olivera-Angel, Luisa Ortíz, Duván Nanclares, Sara Velásquez-Restrepo, Juan Díaz-Nieto
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Pulgarín-R PC, Olivera-Angel M, Ortíz L, Nanclares D, Velásquez-Restrepo S, Díaz-Nieto JF (2021) DNA barcodes of birds from northern Colombia. Biodiversity Data Journal 9: e64842. https://doi.org/10.3897/BDJ.9.e64842
|
|
DNA barcode datasets are a useful tool for conservation and aid in taxonomic identification, particularly in megadiverse tropical countries seeking to document and describe its biota, which is dropping at an alarming rate during recent decades. Here we report the barcodes for several low elevation bird species from northern Colombia with the goal to provide tools for species identification in this region of South America. We blood-sampled birds in a lowland tropical forest with various degrees of intervention using standard 3 × 12 m mist-nets. We extracted DNA and sequenced the COI barcode gene using standard primers and laboratory methods. We obtained 26 COI sequences from 18 species, 10 families and three orders and found that barcodes largely matched (but not always) phenotypic identification (> 90%) and they also facilitated the identification of several challenging passerine species. Despite our reduced sampling, our study represents the first attempt to document COI barcodes for birds (from blood samples) in this part of Colombia, which fills a considerable gap of sampling in this part of South America.
aves, lowland tropical forest, mtDNA, northern Colombia
DNA barcode reference libraries are a useful tool for conservation and aid in taxonomic identification (
Barcode studies in Neotropical birds are on the increase, particularly in Brazil and Argentina, where studies have focused on testing species limits and biogeographic patterns (
We sampled birds at “Hacienda Universidad de Antioquia”, in the Municipality of Caucasia, Department of Antioquia, Colombia (
We extracted total DNA from blood using the PureLink Genomic DNA Mini Kit (Invitrogen) according to the manufacturer’s specifications. For blood samples, 20 µl of Proteinase K, 20 µl of RNase and 200 µl of PureLink® Genomic Lysis/Binding buffer were added during the digestion phase. Later, each sample was transferred to a spin column and two washes were performed with Wash Buffer 1 and Wash Buffer 2 to perform a final elusion, dividing the total volume into two consecutive sets of 50 µl with Elution Buffer.
For molecular typing, we targeted the Cytochrome c oxidase subunit 1 (COI) barcode region, using the primer combination from
Primers used for the amplification of COI sequences obtained in this study.
Name |
Sequence + M13 |
Ratio |
Source |
LepF1_t1-M13FWD |
GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG |
1 |
|
VF1_t1-M13FWD |
GTAAAACGACGGCCAGTTTCTCAACCAACCACAAAGACATTGG |
1 |
|
VF1d_t1-M13FWD |
GTAAAACGACGGCCAGTTTCTCAACCAACCACAARGAYATYGG |
1 |
|
VF1i_t1-M13FWD |
GTAAAACGACGGCCAGTTTCTCAACCAACCAIAAIGAIATIGG |
3 |
|
LepRI_t1-M13REV |
CAGGAAACAGCTATGACCTAAACTTCTGGATGTCCAAAAAATCA |
1 |
|
VR1d_t1-M13REV |
CAGGAAACAGCTATGACCTAGACTTCTGGGTGGCCRAARAAYCA |
1 |
|
VR1_t1-M13REV |
CAGGAAACAGCTATGACCTAGACTTCTGGGTGGCCAAAGAATCA |
1 |
|
VR1i_t1-M13REV |
CAGGAAACAGCTATGACCTAGACTTCTGGGTGICCIAAIAAICA |
3 |
|
M13REV |
CAGGAAACAGCTATGACC |
NA |
|
M13FWD |
GTAAAACGACGGCCAGT |
NA |
|
Sequences were edited, assembled and examined with reference to translated amino-acid sequences, using Geneious PRO 6.1.6. Nucleotide-sequences and complementary information were deposited in BOLD (www.barcodinglife.org) with the accession number dataset CANDE030-20 to CANDE055-20. For an initial sequence quality check and provisionary identification, all assembled sequences were searched in the National Centre for Biotechnology Information (NCBI) database through BLAST (http://BLAST.ncbi.nlm.nih.gov/BLAST.cgi), using the Geneious Pro 6.1.6 match tool. We used the top-matching hit having the highest (> 98%) maximal percent identity score as criteria for successful conspecific/congeneric identification. After the initial BLAST-based identification on the NCBI database, we used the Animal Identification (COI) tool from the BOLD Identification System (IDS), using the Species Level Barcode Records database. For all our sequences, we recovered the species identification, closest matching BIN (Table
Individuals sampled and barcoded in this study. Individuals with * represent boreal migrants. Bolded taxa represent inconsistencies between our identification methods (see text).
Code |
Field ID |
BOLD ID |
BOLD hit1 (%) |
NCBI ID |
NCBI hit1(%) |
Consensus sp BOLD ID |
Seq length (bp) |
BIN |
LCA35 |
Automolus ochrolaemus |
A. ochrolaemus |
100 |
A. ochrolaemus |
99.10 |
A. ochrolaemus |
671 |
|
LCA9 |
Cantorchilus leucotis |
C. leucotis |
100 |
C. leucotis |
95.55 |
C. leucotis |
690 |
|
LCA12 |
Catharus minimus |
C. minimus |
100 |
C. minimus |
100 |
C. minimus* |
657 |
|
LCA30 |
Catharus minimus |
C. minimus |
100 |
C. minimus* |
100 |
C. minimus* |
660 |
|
LCA3 |
Catharus ustulatus |
C. ustulatus* |
100 |
C. ustulatus* |
100 |
C. ustulatus* |
702 |
|
LCA26 |
Chaetura sp |
C. brachyura |
100 |
C. brachyura |
100 |
C. brachyura |
644 |
|
LCA27 |
Chaetura sp |
C. brachyura |
100 |
C. brachyura |
100 |
C. brachyura |
642 |
|
LCA28 |
Chaetura sp |
C. brachyura |
100 |
C. brachyura |
100 |
C. brachyura |
652 |
|
LCA24 |
Coereba flaveola |
C. flaveola |
100 |
C. flaveola |
100 |
C. flaveola |
651 |
|
LCA33 |
Dendrocincla fuliginosa |
D. fuliginosa |
99.85 |
D. fuliginosa |
99.15 |
D. fuliginosa |
673 |
|
LCA20 |
Elaenia flavogaster |
E. flavogaster |
99.85 |
E. flavogaster |
98.93 |
E. flavogaster |
681 |
|
LCA6 |
Elaenia flavogaster |
E. flavogaster |
100 |
E. flavogaster |
99.39 |
E. flavogaster |
696 |
|
LCA18 |
Galbula ruficauda |
G. ruficauda |
100 |
G. ruficauda |
97.55 |
G. ruficauda |
675 |
|
LCA31 |
Manacus manacus |
M. aurantiacus |
100 |
M. manacus |
100 |
M. aurantiacus |
667 |
|
LCA36 |
Manacus manacus |
M. aurantiacus |
100 |
M. manacus |
100 |
M. aurantiacus |
663 |
|
LCA38 |
Manacus manacus |
M. aurantiacus |
100 |
M. manacus |
100 |
M. aurantiacus |
667 |
|
LCA4 |
Momotus subrufescens |
M. momota |
100 |
M. momota |
96.92 |
M. momota |
681 |
|
LCA7 |
Momotus subrufescens |
M. momota |
100 |
M. momota |
97.41 |
M. momota |
657 |
|
LCA21 |
Myiodinastes maculatus |
M. luteiventris |
100 |
M. luteiventris* |
100 |
M. luteiventris* |
651 |
|
LCA22 |
Myiozetetes cayanensis |
M. cayanensis |
99.85 |
M. cayanensis |
98.77 |
M. cayanensis |
660 |
|
LCA13 |
Parkesia noveboracensis |
P. noveboracensis |
100 |
P. noveboracensis |
99.85 |
P. noveboracensis* |
658 |
|
LCA15 |
Ramphocelus dimidiatus |
R. dimidiatus |
100 |
R. carbo |
99.39 |
R. dimidiatus |
681 |
|
LCA40 |
Ramphocelus dimidiatus |
R. dimidiatus |
100 |
R. carbo |
99.23 |
R. dimidiatus |
654 |
|
LCA1 |
Sporophila funerea |
S. funerea |
100 |
S. angloennsis |
98.92 |
S. funerea |
687 |
|
LCA19 |
Tolmomyias sulphurescens |
T. sulphurescens |
99.85 |
T. sulphurescens |
97.89 |
T. sulphurescens |
666 |
|
LCA8 |
Xiphorhynchus susurrans |
X. susurrans |
99.54 |
X. guttatus |
98.15 |
X. susurrans |
670 |
We obtained 26 COI sequences from 18 species, 10 families and three orders and, when analysed by BOLD, the species were grouped into 18 existing BINS (access numbers in Table
Most COI barcodes matched our initial phenotypic identification; however, for six (6) species, (10 individuals), we found differences between our field identification, the query hits from BOLD’s IDS and the NCBI BLAST search (Table
Our assessment of species identification, using the COI barcodes, shows a strong correspondence (90%) with field identification, based on research expertise and photo ID (Table
Similarly, barcodes might help to identify the breeding areas or population origin for species exhibiting migratory divide or genetic structure, as happened with passing through northern South America species, Catharus minimus and Catharus ustulatus (
We also found some discrepancies between IDs recovered by the NCBI BLAST tool, those recovered by BOLD and our initial identifications made in the field. For example, three specimens identified in the field (Fig.
Another result that showed some inconsistencies was the identification of LCA4 and LCA7 sequences, which were recovered by BOLD as Momotus momota (Fig. 4). This used to be a widely-distributed species in Central and South America, until it was split into five species-level taxa (M. aequatorialis, M. bahamensis, M. lessonii, M. momota and M. subrufescens), using a combined analysis of plumage, biometrics and voice (
A final group of inconsistencies between identification methods corresponds to three (3) species for which no COI sequence data are available at the NCBI portal and, consequently, their closest matching sequences are inconsistent with their correct field- and BOLD-based identifications. In the case of the genera Ramphocelus and Xiphorhynchus, the BLAST search tool identified our samples as the cis-Andean distributed congeneric species (R. carbo and X. guttatus) and not as the correct trans-Andean species, R. dimidiatus and X. sussurrans (
Even though we found some discrepancies between our identification methods compared to BOLD’s IDS, a close inspection to the K2P trees from BOLD (Fig.
Despite our reduced sampling, this study represents the first attempt to document COI barcodes for birds (from blood samples) in this part of Colombia, which fills a considerable gap in sampling in north-western South America. Particularly, a call for broader sampling for barcodes might provide hints on cryptic species across barriers (
This research was partially funded by Universidad de Antioquia through the grant "Sostenibilidad 2016-2017 Codi". Fieldwork was developed under the permit "Resolución 0524 del 27 de mayo de 2014" issued by the Colombian National Authority of Environmental Licences (ANLA, by its initials in Spanish) to Universidad de Antioquia. We are grateful to Diego Calderón-Franco and two anonymous reviewers for their comments that helped to improve the present manuscript.